PBR (TSPO) (NM_001256531) Human Untagged Clone

CAT#: SC330447

TSPO (untagged) - Homo sapiens translocator protein (18kDa) (TSPO), transcript variant 4


  "NM_001256531" in other vectors (2)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TSPO"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TSPO
Synonyms BPBS; BZRP; DBI; IBP; MBR; mDRC; PBR; PBS; pk18; PKBS; PTBR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001256531, the custom clone sequence may differ by one or more nucleotides


ATGGCCCCGCCCTGGGTGCCCGCCATGGGCTTCACGCTGGCGCCCAGCCTGGGGTGCTTCGTGGGCTCCC
GCTTTGTCCACGGCGAGGGTCTCCGCTGGTACGCCGGCCTGCAGAAGCCCTCGTGGCACCCGCCCCACTG
GGTGCTGGGCCCTGTCTGGGGCACGCTCTACTCAGCCATGGGGTACGGCTCCTACCTGGTCTGGAAAGAG
CTGGGAGGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGG
CATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGG
GGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTAC
CTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGG
GACGGCGGCTGCCAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256531
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256531.1, NP_001243460.1
RefSeq Size 1025 bp
RefSeq ORF 510 bp
Locus ID 706
Cytogenetics 22q13.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]'
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant PBR. Variants PBR, 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.