Monoacylglycerol Lipase (MGLL) (NM_001256585) Human Untagged Clone
CAT#: SC330462
MGLL (untagged) - Homo sapiens monoglyceride lipase (MGLL), transcript variant 3
"NM_001256585" in other vectors (2)
Product Images
Other products for "MGLL"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MGLL |
Synonyms | HU-K5; HUK5; MAGL; MGL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256585, the custom clone sequence may differ by one or more nucleotides
ATGGAAACAGGACCTGAAGACCCTTCCAGCATGCCAGAGGAAAGTTCCCCCAGGCGGACCCCGCAGAGCA TTCCCTACCAGGACCTCCCTCACCTGGTCAATGCAGACGGACAGTACCTCTTCTGCAGGTACTGGAAACC CACAGGCACACCCAAGGCCCTCATCTTTGTGTCCCATGGAGCCGGAGAGCACAGTGGCCGCTATGAAGAG CTGGCTCGGATGCTGATGGGGCTGGACCTGCTGGTGTTCGCCCACGACCATGTTGGCCACGGACAGAGCG AAGGGGAGAGGATGGTAGTGTCTGACTTCCACGTTTTCGTCAGGGATGTGTTGCAGCATGTGGATTCCAT GCAGAAAGACTACCCTGGGCTTCCTGTCTTCCTTCTGGGCCACTCCATGGGAGGCGCCATCGCCATCCTC ACGGCCGCAGAGAGGCCGGGCCACTTCGCCGGCATGGTACTCATTTCGCCTCTGGTTCTTGCCAATCCTG AATCTGCAACAACTTTCAAGGTCGACATTTATAACTCAGACCCCCTGATCTGCCGGGCAGGGCTGAAGGT GTGCTTCGGCATCCAACTGCTGAATGCCGTCTCACGGGTGGAGCGCGCCCTCCCCAAGCTGACTGTGCCC TTCCTGCTGCTCCAGGGCTCTGCCGATCGCCTATGTGACAGCAAAGGGGCCTACCTGCTCATGGAGTTAG CCAAGAGCCAGGACAAGACTCTCAAGATTTATGAAGGTGCCTACCATGTTCTCCACAAGGAGCTTCCTGA AGTCACCAACTCCGTCTTCCATGAAATAAACATGTGGGTCTCTCAAAGGACAGCCACGGCAGGAACTGCG TCCCCACCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256585 |
ORF Size | 852 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256585.1, NP_001243514.1 |
RefSeq Size | 4563 |
RefSeq ORF | 852 |
Locus ID | 11343 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Glycerolipid metabolism, Metabolic pathways |
Gene Summary | This gene encodes a serine hydrolase of the AB hydrolase superfamily that catalyzes the conversion of monoacylglycerides to free fatty acids and glycerol. The encoded protein plays a critical role in several physiological processes including pain and nociperception through hydrolysis of the endocannabinoid 2-arachidonoylglycerol. Expression of this gene may play a role in cancer tumorigenesis and metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (3) lacks an exon in the 3' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.