Apc10 (ANAPC10) (NM_001256708) Human Untagged Clone

CAT#: SC330504

ANAPC10 (untagged) - Homo sapiens anaphase promoting complex subunit 10 (ANAPC10), transcript variant 4


  "NM_001256708" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANAPC10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANAPC10
Synonyms APC10; DOC1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256708, the custom clone sequence may differ by one or more nucleotides


ATGACTACACCAAACAAGACACCTCCTGGTGCTGACCCCAAGCAGTTGGAAAGGACTGGAACAGTACGGG
AAATTGGGTCACAAGCTGTTTGGTCACTCTCATCTTGCAAACCAGGATTTGGAGTGGATCAGTTACGAGA
TGACAATCTAGAAACTTATTGGCAATCAGATGGTTCCCAGCCTCATTTAGTGAACATCCAATTCAGAAGA
AAAACAACAGTGAAGACATTATGTATTTATGCAGACTACAAATCTGATGAAAGCTATACTCCAAGCAAGA
TCTCAGTCAGAGTAGGAAATAATTTTCACAACCTTCAAGAAATTCGGCAACTTGAGTTGGTGGAACCAAG
TGGCTGGATTCATGTTCCCTTAACTGACAATCATAAGAAGCCAACTCGTACATTCATGATACAGATTGCT
GTTCTAGCCAATCACCAGAATGGAAGAGACACCCATATGAGACAAATTAAAATATACACACCAGTAGAAG
AGAGCTCCATTGGTAAATTTCCTAGATGTACAACTATAGATTTCATGATGTATCGTTCAATAAGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256708
ORF Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256708.1, NP_001243637.1
RefSeq Size 1674
RefSeq ORF 558
Locus ID 10393
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
Gene Summary ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]). [supplied by OMIM, Feb 2011]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.