ABR (NM_001256847) Human Untagged Clone

CAT#: SC330533

ABR (untagged) - Homo sapiens active BCR-related (ABR), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABR
• Synonyms: MDB
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256847, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCGACGTCCTGCCCCAGCCCGACTGCAGCCCGAAGGCGGGGCGCGAACCCCTGGCGCTGGAGGAGT
  CGGGGAGCAAGCGCCCCCCCAACACCGGCGCCCGGCTCTGGGGCCGCGTGCGCAACAAGCTGCTCCGAAA
  CAAGCTGGACCCACAAACCGTGGAGACCAAGAACTGGCACACGGACGTGATTGAGATGAACGGGATCAAA
  GTGGAATTTTCCATGAAATTCACCAGCCGAGATATGAGCCTGAAGAGGACCCCGTCCAAAAAGCAGACCG
  GCGTCTTCGGTGTGAAGATCAGCGTGGTGACGAAGCGGGAGCGCTCCAAGGTGCCCTACATCGTCCGGCA
  GTGTGTGGAGGAGGTGGAGAAGAGGGGTATCGAGGAGGTTGGCATCTACAGGATATCGGGCGTGGCCACG
  GACATCCAGGCGCTCAAGGCCGTCTTCGATGCCAATAACAAGGACATCCTGCTGATGCTGAGTGACATGG
  ACATCAACGCCATCGCCGGGACGCTCAAGCTGTACTTCCGGGAACTGCCCGAGCCGCTCCTCACGGACCG
  ACTCTACCCAGCCTTCATGGAGGGCATCGCCCTGTCAGACCCTGCTGCCAAGGAAAACTGCATGATGCAC
  CTGCTCCGCTCCCTGCCCGACCCCAACCTCATCACCTTCCTCTTCCTGCTGGAACACTTGAAAAGGGTTG
  CCGAGAAGGAGCCCATCAACAAAATGTCACTTCACAACCTGGCTACCGTGTTTGGACCCACGTTACTGAG
  ACCCTCAGAAGTGGAGAGCAAAGCACACCTCACCTCGGCTGCGGACATCTGGTCCCATGACGTCATGGCG
  CAGGTCCAGGTCCTCCTCTACTACCTGCAGCACCCCCCCATTTCCTTCGCAGAACTCAAGCGGAACACAC
  TGTACTTCTCCACCGACGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256847
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256847.2, NP_001243776.1
• RefSeq Size: 3601 bp
• RefSeq ORF: 933 bp
• Locus ID: 29
• Cytogenetics: 17p13.3
• Gene Summary: 'This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]'
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a large portion of the coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) has a distinct N-terminus and is shorter than isoform a.