POLD4 (NM_001256870) Human Untagged Clone

CAT#: SC330547

POLD4 (untagged) - Homo sapiens polymerase (DNA-directed), delta 4, accessory subunit (POLD4), transcript variant 2


  "NM_001256870" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLD4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLD4
Synonyms p12; POLDS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256870, the custom clone sequence may differ by one or more nucleotides


ATGGGCCGGAAGCGGCTCATCACTGATTCCTACCCGGTTGTGAAGAGGAGGGAGGGGCCCGCTGGGCACA
GCAAGGGGGAGCTGGCACCCGAGCTAGGGGAGGAGCCCCAGCCCCGCGACGAGGAGGAAGCGGAGCTGGA
GCTGCTGAGGCAGTTTGACCTGGCCTGGCAGTACGGGCCCTGCACCGTCTCTGGCATCTCTATCCCCTAT
GAGGCACCACGTAAGACCTCCTGCCCTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256870
ORF Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256870.1, NP_001243799.1
RefSeq Size 1639
RefSeq ORF 240
Locus ID 57804
Protein Pathways Base excision repair, DNA replication, Homologous recombination, Metabolic pathways, Mismatch repair, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism
Gene Summary This gene encodes the smallest subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein enhances the activity of DNA polymerase delta and plays a role in fork repair and stabilization through interactions with the DNA helicase Bloom syndrome protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.