POLD4 (NM_001256870) Human Untagged Clone

CAT#: SC330547

POLD4 (untagged) - Homo sapiens polymerase (DNA-directed), delta 4, accessory subunit (POLD4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLD4
• Synonyms: p12; POLDS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256870, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCCGGAAGCGGCTCATCACTGATTCCTACCCGGTTGTGAAGAGGAGGGAGGGGCCCGCTGGGCACA
  GCAAGGGGGAGCTGGCACCCGAGCTAGGGGAGGAGCCCCAGCCCCGCGACGAGGAGGAAGCGGAGCTGGA
  GCTGCTGAGGCAGTTTGACCTGGCCTGGCAGTACGGGCCCTGCACCGTCTCTGGCATCTCTATCCCCTAT
  GAGGCACCACGTAAGACCTCCTGCCCTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256870
• ORF Size: 240 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256870.1, NP_001243799.1
• RefSeq Size: 1639
• RefSeq ORF: 240
• Locus ID: 57804
• Protein Pathways: Base excision repair, DNA replication, Homologous recombination, Metabolic pathways, Mismatch repair, Nucleotide excision repair, Purine metabolism, Pyrimidine metabolism
• Gene Summary: This gene encodes the smallest subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein enhances the activity of DNA polymerase delta and plays a role in fork repair and stabilization through interactions with the DNA helicase Bloom syndrome protein. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
  Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.