SR1 (SRI) (NM_001256892) Human Untagged Clone

CAT#: SC330556

SRI (untagged) - Homo sapiens sorcin (SRI), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRI
• Synonyms: CP-22; CP22; SCN; V19
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256892, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGTATGGAGGGGCTCCCGGAGGGCCTGCGTTTCCCGGACAAACTCAGGATCCGCTGTATGGTTACT
  TTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATGTCTGACACAGTCTGG
  CATTGCTGGAGGATACAAACCTTTTAACCTGGAGACTTGCCGGCTTATGGTTTCAATGCTGGATAGAGAT
  ATGTCTGGCACAATGGGTTTCAATGAATTTAAAGAACTCTGGGCTGTACTGAATGGCTGGAGACAACACT
  TTATCAGTTTTGACACTGACAGGAGTGGAACAGTAGACCCACAAGAATTGCAGAAGGCCCTGACAACAAT
  GGGATTTAGGTTGAGTCCCCAGGCTGTGAATTCAATTGCAAAACGATACAGCACCAATGGAAAGATCACC
  TTCGACGACTACATCGCCTGCTGCGTCAAACTGAGGGCTCTTACAGACAGCTTTCGAAGACGGGATACTG
  CTCAGCAAGGTGTTGTGAATTTCCCATATGATGATGTAAGTCTTAGAAATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256892
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256892.1, NP_001243821.1
• RefSeq Size: 908 bp
• RefSeq ORF: 543 bp
• Locus ID: 6717
• Cytogenetics: 7q21.12
• Protein Families: Druggable Genome
• Gene Summary: 'This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]'
  Transcript Variant: This variant (4) has multiple differences compared to variant 1. These differences result in a protein (isoform D) with shorter and distinct N- and C-termini, compared to isoform A.