Caspase 1 (CASP1) (NM_001257118) Human Untagged Clone

CAT#: SC330567

CASP1 (untagged) - Homo sapiens caspase 1, apoptosis-related cysteine peptidase (CASP1), transcript variant 6


  "NM_001257118" in other vectors (2)

Reconstitution Protocol

USD 400.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CASP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CASP1
Synonyms ICE; IL1BC; P45
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001257118, the custom clone sequence may differ by one or more nucleotides


ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCATGGGTGAAGGTACAATAAATG
GCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAAGGAAGAGATGGAGAAAGTAAAACGTGAAAA
TGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGCCAA
ATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGATCAAA
CATCTGGAAATTACCTTAATATGCAAGACTCTCAAGGAGTACTTTCTTCCTTTCCAGCTCCTCAGGCAGT
GCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTCAAGCTTTGCTCCCTAGAAGAA
GCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTATCCAATAATGGACAAGTCAAGCCGCACACGTC
TTGCTCTCATTATCTGCAATGAAGAATTTGACAGTATTCCTAGAAGAACTGGAGCTGAGGTTGACATCAC
AGGCATGACAATGCTGCTACAAAATCTGGGGTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCGGAC
ATGACTACAGAGCTGGAGGCATTTGCACACCGCCCAGAGCACAAGACCTCTGACAGCACGTTCCTGGTGT
TCATGTCTCATGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCAGATATACTACA
ACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAGGACAAACCGAAGGTGATC
ATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGATTCAGTAGGAGTTTCTGGAA
ACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAAGCCCACATAGAGAAGGATTT
TATCGCTTTCTGCTCTTCCACACCAGATAATGTTTCTTGGAGACATCCCACAATGGGCTCTGTTTTTATT
GGAAGACTCATTGAACATATGCAAGAATATGCCTGTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTC
GATTTTCATTTGAGCAGCCAGATGGTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATG
TTTCTACCTCTTCCCAGGACATTAA


Restriction Sites SgfI-MluI     
ACCN NM_001257118
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257118.1, NP_001244047.1
RefSeq Size 2019 bp
RefSeq ORF 2019 bp
Locus ID 834
Cytogenetics 11q22.3
Protein Families Druggable Genome, Protease
Protein Pathways Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway
Gene Summary 'This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (6) differs in the 3' UTR compared to variant alpha. Variant alpha and variant 6 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.