Glycerol 3 Phosphate Dehydrogenase (GPD1) (NM_001257199) Human Untagged Clone
CAT#: SC330577
GPD1 (untagged) - Homo sapiens glycerol-3-phosphate dehydrogenase 1 (soluble) (GPD1), transcript variant 2
"NM_001257199" in other vectors (2)
Product Images
Other products for "GPD1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GPD1 |
Synonyms | GPD-C; GPDH-C; HTGTI |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001257199, the custom clone sequence may differ by one or more nucleotides
ATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTG GCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGG CAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCC CCAAATGTGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATAT CTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCT CGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAG ACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCC GTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGG GGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATG GAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTG GTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTAC AGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCC CGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACA AGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTG A |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257199 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001257199.1, NP_001244128.1 |
RefSeq Size | 3014 bp |
RefSeq ORF | 981 bp |
Locus ID | 2819 |
Cytogenetics | 12q13.12 |
Protein Pathways | Glycerophospholipid metabolism |
Gene Summary | 'This gene encodes a member of the NAD-dependent glycerol-3-phosphate dehydrogenase family. The encoded protein plays a critical role in carbohydrate and lipid metabolism by catalyzing the reversible conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. The encoded cytosolic protein and mitochondrial glycerol-3-phosphate dehydrogenase also form a glycerol phosphate shuttle that facilitates the transfer of reducing equivalents from the cytosol to mitochondria. Mutations in this gene are a cause of transient infantile hypertriglyceridemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]' Transcript Variant: This variant (2) uses an alternate splice site in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.