DIS3L2 (NM_001257282) Human Untagged Clone
CAT#: SC330593
DIS3L2 (untagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3
"NM_001257282" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DIS3L2 |
Synonyms | FAM6A; hDIS3L2; PRLMNS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001257282, the custom clone sequence may differ by one or more nucleotides
ATGAGCCATCCTGACTACAGAATGAACCTCCGGCCCCTGGGGACCCCCAGAGGTGTGTCTGCTGTGGCTG GTCCACATGACATTGGTGCTTCGCCAGGTGACAAAAAGTCAAAGAACAGGTCCACACGAGGGAAGAAAAA GAGCATATTTGAAACTTACATGTCCAAGGAGGATGTTTCAGAAGGCTTGAAGAGAGGAACACTCATCCAG GGTGTATTGAGAATTAATCCAAAGAAGTTTCATGAAGCCTTCATTCCTTCCCCGGATGGTGATCGAGACA TTTTTATTGATGGGGTTGTTGCTCGTAATAGAGCCTTAAATGGGGATCTGGTGGTCGTGAAACTGCTTCC CGAGGAGCATTGGAAGGTAGTTAAACCAGAGAGCAATGACAAAGAAACAGAAGCTGCGTATGAATCAGAT ATCCCCGAGGAGCTCTGTGGACACCATCTCCCGCAACAGTCCCTGAAAAGCTATAATGACAGTCCTGATG TCATTGTAGAGGCTCAGTTTGATGGCAGCGACTCAGAAGATGGACATGGCATCACACAAAATGTGCTGGT TGATGGTGTTAAGAAACTCTCAGTTTGTGTTTCTGAGAAAGGAAGAGAGGATGGTGATGCACCGGTTACA AAAGATGAGACCACCTGCATTTCACAAGACACAAGAGCTTTATCGGAGAAATCCCTGCAAAGATCAGCAA AGGTCATTGCCTACAGATTTTCTCCACGTGTCCAAATGGCTTTCACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257282 |
ORF Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001257282.1, NP_001244211.1 |
RefSeq Size | 1154 |
RefSeq ORF | 750 |
Locus ID | 129563 |
Gene Summary | The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232280 | DIS3L2 (Myc-DDK tagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3 |
USD 420.00 |
|
RG232280 | DIS3L2 (GFP-tagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review