DIS3L2 (NM_001257282) Human Untagged Clone

CAT#: SC330593

DIS3L2 (untagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3


  "NM_001257282" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DIS3L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DIS3L2
Synonyms FAM6A; hDIS3L2; PRLMNS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257282, the custom clone sequence may differ by one or more nucleotides


ATGAGCCATCCTGACTACAGAATGAACCTCCGGCCCCTGGGGACCCCCAGAGGTGTGTCTGCTGTGGCTG
GTCCACATGACATTGGTGCTTCGCCAGGTGACAAAAAGTCAAAGAACAGGTCCACACGAGGGAAGAAAAA
GAGCATATTTGAAACTTACATGTCCAAGGAGGATGTTTCAGAAGGCTTGAAGAGAGGAACACTCATCCAG
GGTGTATTGAGAATTAATCCAAAGAAGTTTCATGAAGCCTTCATTCCTTCCCCGGATGGTGATCGAGACA
TTTTTATTGATGGGGTTGTTGCTCGTAATAGAGCCTTAAATGGGGATCTGGTGGTCGTGAAACTGCTTCC
CGAGGAGCATTGGAAGGTAGTTAAACCAGAGAGCAATGACAAAGAAACAGAAGCTGCGTATGAATCAGAT
ATCCCCGAGGAGCTCTGTGGACACCATCTCCCGCAACAGTCCCTGAAAAGCTATAATGACAGTCCTGATG
TCATTGTAGAGGCTCAGTTTGATGGCAGCGACTCAGAAGATGGACATGGCATCACACAAAATGTGCTGGT
TGATGGTGTTAAGAAACTCTCAGTTTGTGTTTCTGAGAAAGGAAGAGAGGATGGTGATGCACCGGTTACA
AAAGATGAGACCACCTGCATTTCACAAGACACAAGAGCTTTATCGGAGAAATCCCTGCAAAGATCAGCAA
AGGTCATTGCCTACAGATTTTCTCCACGTGTCCAAATGGCTTTCACCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001257282
ORF Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001257282.1, NP_001244211.1
RefSeq Size 1154
RefSeq ORF 750
Locus ID 129563
Gene Summary The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.