FE65 (APBB1) (NM_001257320) Human Untagged Clone

CAT#: SC330597

APBB1 (untagged) - Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 6


  "NM_001257320" in other vectors (2)

Reconstitution Protocol

USD 460.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "APBB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APBB1
Synonyms FE65; MGC:9072; RIR
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257320, the custom clone sequence may differ by one or more nucleotides


ATGAGGGTCCAGGACACCTCAGGGACCTATTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCCC
CCGGCCGGGCCTCCCCCTCACAGGGGAGCAGCCCCCAAGAGGAGTCCCAGCTCACCTGGACAGGTTTTGC
TCATGGAGAAGGCTTTGAGGATGGAGAATTTTGGAAGGATGAACCCAGTGATGAGGCCCCAATGGAGCTG
GGACTGAAGGAACCTGAGGAGGGGACGTTGACCTTCCCAGCTCAGAGCCTCAGCCCAGAGCCGTTGCCCC
AAGAGGAGGAGAAGCTTCCCCCACGGAATACCAACCCAGGGATCAAGTGTTTCGCCGTGCGCTCCCTAGG
CTGGGTAGAGATGACCGAGGAGGAGCTGGCCCCTGGACGCAGCAGTGTGGCAGTCAACAATTGCATCCGT
CAGCTCTCTTACCACAAAAACAACCTGCATGACCCCATGTCTGGGGGCTGGGGGGAAGGAAAGGATCTGC
TACTGCAGCTGGAGGATGAGACACTAAAGCTAGTGGAGCCACAGAGCCAGGCACTGCTGCACGCCCAACC
CATCATCAGCATCCGCGTGTGGGGCGTCGGGCGGGACAGTGGAAGAGAGAGGGACTTTGCCTACGTAGCT
CGTGATAAGCTGACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAGAACATCGCCA
CCAGCCTGCATGAGATCTGCTCTAAGATCATGGCCGAACGGCGTAATGCCCGCTGCTTGGTAAATGGACT
CTCCCTGGACCACTCTAAACTTGTGGATGTCCCTTTCCAAGTGGAATTCCCAGCGCCTAAGAATGAGTTG
GTCCAGAAGTTCCAAGTCTATTACCTGGGGAATGTACCTGTTGCTAAACCTGTTGGGGTAGATGTGATTA
ATGGGGCCCTCGAGTCAGTCCTGTCCTCCAGCAGCCGTGAACAATGGACCCCAAGTCATGTCAGTGTGGC
CCCTGCTACCCTCACCATCTTGCACCAGCAGACAGAGGCAGTGCTGGGAGAGTGTCGGGTGCGTTTCCTC
TCCTTCCTGGCCGTGGGCAGAGATGTCCACACGTTTGCATTCATCATGGCTGCCGGCCCAGCCTCCTTCT
GCTGCCACATGTTCTGGTGCGAGCCCAATGCTGCCAGCCTCTCAGAGGCTGTGCAGGCTGCGTGCATGCT
TCGCTACCAGAAGTGTCTGGATGCCCGTTCCCAGGCCTCCACCTCCTGCCTCCCAGCACCCCCTGCTGAG
TCTGTGGCACGGCGTGTAGGGTGGACTGTCCGCAGGGGTGTTCAGTCGCTGTGGGGCTCCCTGAAGCCCA
AACGGCTGGGGGCCCATACCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001257320
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257320.2, NP_001244249.1
RefSeq Size 2114 bp
RefSeq ORF 1356 bp
Locus ID 322
Cytogenetics 11p15.4
Protein Families Transcription Factors
Protein Pathways Alzheimer's disease
Gene Summary 'The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (6) represents use of an alternate promoter and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (d) with a shorter N-terminus, compared to isoform 1. Variants 4, 5, and 6 all encode the same isoform (d).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.