CD63 (NM_001257392) Human Untagged Clone

CAT#: SC330612

CD63 (untagged) - Homo sapiens CD63 molecule (CD63), transcript variant 7


  "NM_001257392" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD63"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD63
Synonyms LAMP-3; ME491; MLA1; OMA81H; TSPAN30
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257392, the custom clone sequence may differ by one or more nucleotides


ATGGCGGTGGAAGGAGGAATGAAATGTGTGAAGTTCTTGCTCTACGTCCTCCTGCTGGCCTTTTGCGGGG
CTACCCCTGGCTCTCTGTTGCCAGTGGTCATCATCGCAGTGGGTGTCTTCCTCTTCCTGGTGGCTTTTGT
GGGCTGCTGCGGGGCCTGCAAGGAGAACTATTGTCTTATGATCACGTTTGCCATCTTTCTGTCTCTTATC
ATGTTGGTGGAGGTGGCCGCAGCCATTGCTGGCTATGTGTTTAGAGATAAGGTGATGTCAGAGTTTAATA
ACAACTTCCGGCAGCAGATGGAGAATTACCCGAAAAACAACCACACTGCTTCGATCCTGGACAGGATGCA
GGCAGATTTTAAGTGCTGTGGGGCTGCTAACTACACAGATTGGGAGAAAATCCCTTCCATGTCGAAGAAC
CGAGTCCCCGACTCCTGCTGCATTAATGTTACTGTGGGCTGTGGGATTAATTTCAACGAGAAGGCGATCC
ATAAGGAGGGCTGTGTGGAGAAGATTGGGGGCTGGCTGAGGAAAAATGTGCTGGTGGTAGCTGCAGCAGC
CCTTGGAATTGCTTTTGTCGAGGTTTTGGGAATTGTCTTTGCCTGCTGCCTCGTGAAGAGTATCAGAAGT
GGCTACGAGGTGATGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001257392
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257392.1, NP_001244321.1
RefSeq Size 777 bp
RefSeq ORF 648 bp
Locus ID 967
Cytogenetics 12q13.2
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome
Gene Summary 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (7) has an alternate splice site in the 5' coding region, compared to variant 1. The resulting isoform (C) lacks an internal segment, compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.