HMBS (NM_001258209) Human Untagged Clone

CAT#: SC330637

HMBS (untagged) - Homo sapiens hydroxymethylbilane synthase (HMBS), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HMBS
• Synonyms: PBG-D; PBGD; PORC; UPS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258209, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCAA
  CATTGAAAGCCTCGTACCCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGGGACAAGATTCT
  TGATACTGCACTCTCTAAGATTGGAGAGAAAAGCCTGTTTACCAAGGAGCTTGAACATGCCCTGGAGAAG
  AATGAAGTGGACCTGGTTGTTCACTCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCG
  GAGCCATCTGCAAGCGGGAAAACCCTCATGATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAGACCCT
  AGAAACCCTGCCAGAGAAGAGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAGAGAAAG
  TTCCCGCATCTGGAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGACGAGCAGC
  AGGAGTTCAGTGCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAACCGGGTGGGGCA
  GATCCTGCACCCTGAGGAATGCATGTATGCTGTGGGCCAGGAAGGAGGCTGCAGTGTGCCAGTAGCCGTG
  CATACAGCTATGAAGGATGGGCAACTGTACCTGACTGGAGGAGTCTGGAGTCTAGACGGCTCAGATAGCA
  TACAAGAGACCATGCAGGCTACCATCCATGTCCCTGCCCAGCATGAAGATGGCCCTGAGGATGACCCACA
  GTTGGTAGGCATCACTGCTCGTAACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAACTTGGGCATCAGC
  CTGGCCAACTTGTTGCTGAGCAAAGGAGCCAAAAACATCCTGGATGTTGCACGGCAGCTTAACGATGCCC
  ATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258209
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258209.1, NP_001245138.1
• RefSeq Size: 1497 bp
• RefSeq ORF: 915 bp
• Locus ID: 3145
• Cytogenetics: 11q23.3
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Porphyrin and chlorophyll metabolism
• Gene Summary: 'This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) uses an alternate splice junction at the 3' end of the first exon and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (4) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1.