MLH1 (NM_001258274) Human Untagged Clone

CAT#: SC330651

MLH1 (untagged) - Homo sapiens mutL homolog 1 (MLH1), transcript variant 7


  "NM_001258274" in other vectors (2)

Reconstitution Protocol

USD 520.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MLH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MLH1
Synonyms COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001258274, the custom clone sequence may differ by one or more nucleotides


ATGAATGGTTACATATCCAATGCAAACTACTCAGTGAAGAAGTGCATCTTCTTACTCTTCATCAACCATC
GTCTGGTAGAATCAACTTCCTTGAGAAAAGCCATAGAAACAGTGTATGCAGCCTATTTGCCCAAAAACAC
ACACCCATTCCTGTACCTCAGTTTAGAAATCAGTCCCCAGAATGTGGATGTTAATGTGCACCCCACAAAG
CATGAAGTTCACTTCCTGCACGAGGAGAGCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCC
TGGGCTCCAATTCCTCCAGGATGTACTTCACCCAGACTTTGCTACCAGGACTTGCTGGCCCCTCTGGGGA
GATGGTTAAATCCACAACAAGTCTGACCTCGTCTTCTACTTCTGGAAGTAGTGATAAGGTCTATGCCCAC
CAGATGGTTCGTACAGATTCCCGGGAACAGAAGCTTGATGCATTTCTGCAGCCTCTGAGCAAACCCCTGT
CCAGTCAGCCCCAGGCCATTGTCACAGAGGATAAGACAGATATTTCTAGTGGCAGGGCTAGGCAGCAAGA
TGAGGAGATGCTTGAACTCCCAGCCCCTGCTGAAGTGGCTGCCAAAAATCAGAGCTTGGAGGGGGATACA
ACAAAGGGGACTTCAGAAATGTCAGAGAAGAGAGGACCTACTTCCAGCAACCCCAGAAAGAGACATCGGG
AAGATTCTGATGTGGAAATGGTGGAAGATGATTCCCGAAAGGAAATGACTGCAGCTTGTACCCCCCGGAG
AAGGATCATTAACCTCACTAGTGTTTTGAGTCTCCAGGAAGAAATTAATGAGCAGGGACATGAGGTTCTC
CGGGAGATGTTGCATAACCACTCCTTCGTGGGCTGTGTGAATCCTCAGTGGGCCTTGGCACAGCATCAAA
CCAAGTTATACCTTCTCAACACCACCAAGCTTAGTGAAGAACTGTTCTACCAGATACTCATTTATGATTT
TGCCAATTTTGGTGTTCTCAGGTTATCGGAGCCAGCACCGCTCTTTGACCTTGCCATGCTTGCCTTAGAT
AGTCCAGAGAGTGGCTGGACAGAGGAAGATGGTCCCAAAGAAGGACTTGCTGAATACATTGTTGAGTTTC
TGAAGAAGAAGGCTGAGATGCTTGCAGACTATTTCTCTTTGGAAATTGATGAGGAAGGGAACCTGATTGG
ATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCC
ACTGAGGTGAATTGGGACGAAGAAAAGGAATGTTTTGAAAGCCTCAGTAAAGAATGCGCTATGTTCTATT
CCATCCGGAAGCAGTACATATCTGAGGAGTCGACCCTCTCAGGCCAGCAGAGTGAAGTGCCTGGCTCCAT
TCCAAACTCCTGGAAGTGGACTGTGGAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCT
AAACATTTCACAGAAGATGGAAATATCCTGCAGCTTGCTAACCTGCCTGATCTATACAAAGTCTTTGAGA
GGTGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001258274
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258274.1, NP_001245203.1
RefSeq Size 2623 bp
RefSeq ORF 1548 bp
Locus ID 4292
Cytogenetics 3p22.2
Protein Families Druggable Genome
Protein Pathways Colorectal cancer, Endometrial cancer, Mismatch repair, Pathways in cancer
Gene Summary 'The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]'
Transcript Variant: This variant (7) differs in the 5' UTR and contains an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1. Variants 3, 4, and 6-12 all encode the same isoform (3). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.