GALT (NM_001258332) Human Untagged Clone

CAT#: SC330663

GALT (untagged) - Homo sapiens galactose-1-phosphate uridylyltransferase (GALT), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GALT
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258332, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCCTCTCAACCCTCTGTGTCCTGGGGCCATCCGAGCCAACGGAGAGTAAGGTCATGTGCTTCCACC
  CCTGGTCGGATGTAACGCTGCCACTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTC
  AGTCACAGAGGAGCTGGGTGCCCAGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGC
  TGTTCTAACCCCCACCCCCACTGCCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAGCGTGAGG
  AGCGATCTCAGCAGGCCTATAAGAGTCAGCATGGAGAGCCCCTGCTAATGGAGTACAGCCGCCAGGAGCT
  ACTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGTTAGTACTGGTCCCCTTCTGGGCAACATGG
  CCCTACCAGACACTGCTGCTGCCCCGTCGGCATGTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTG
  ATGATCTAGCCTCCATCATGAAGAAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTA
  CTCCATGGGCTGGCATGGGGCTCCCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCAC
  GCTCATTACTACCCTCCGCTCCTGCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAAATGCTTG
  CTCAGGCTCAGAGGGACCTCACCCCTGAGCAGGCTGCAGAGAGACTAAGGGCACTTCCTGAGGTTCATTA
  CCACCTGGGGCAGAAGGACAGGGAGACAGCAACCATCGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258332
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258332.1, NP_001245261.1
• RefSeq Size: 1282 bp
• RefSeq ORF: 813 bp
• Locus ID: 2592
• Cytogenetics: 9p13.3
• Protein Families: Druggable Genome
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Metabolic pathways
• Gene Summary: 'Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
  Transcript Variant: This variant (2) lacks two alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.