Granzyme M (GZMM) (NM_001258351) Human Untagged Clone

CAT#: SC330672

GZMM (untagged) - Homo sapiens granzyme M (lymphocyte met-ase 1) (GZMM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GZMM
• Synonyms: LMET1; MET1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258351, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTCACTGCAGAGAAATGGCTCCCACCTGTGCGGGGGTGTCCTGGTGCACCCAAAGTGGGTGCTGA
  CGGCTGCCCACTGCCTGGCCCAGCGGATGGCCCAGCTGAGGCTGGTGCTGGGGCTCCACACCCTGGACAG
  CCCCGGTCTCACCTTCCACATCAAGGCAGCCATCCAGCACCCTCGCTACAAGCCCGTCCCTGCCCTGGAG
  AACGACCTCGCGCTGCTTCAGCTGGACGGGAAAGTGAAGCCCAGCCGGACCATCCGGCCGTTGGCCCTGC
  CCAGTAAGCGCCAGGTGGTGGCAGCAGGGACTCGGTGCAGCATGGCCGGCTGGGGGCTGACCCACCAGGG
  CGGGCGCCTGTCCCGGGTGCTGCGGGAGCTGGACCTCCAAGTGCTGGACACCCGCATGTGTAACAACAGC
  CGCTTCTGGAACGGCAGCCTCTCCCCCAGCATGGTCTGCCTGGCGGCCGACTCCAAGGACCAGGCTCCCT
  GCAAGGGTGACTCGGGCGGGCCCCTGGTGTGTGGCAAAGGCCGGGTGTTGGCCGGAGTCCTGTCCTTCAG
  CTCCAGGGTCTGCACTGACATCTTCAAGCCTCCCGTGGCCACCGCTGTGGCGCCTTACGTGTCCTGGATC
  AGGAAGGTCACCGGCCGATCGGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258351
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258351.1, NP_001245280.1
• RefSeq Size: 954 bp
• RefSeq ORF: 657 bp
• Locus ID: 3004
• Cytogenetics: 19p13.3
• Protein Families: Druggable Genome, Protease, Secreted Protein, Transmembrane
• Gene Summary: 'Human natural killer (NK) cells and activated lymphocytes express and store a distinct subset of neutral serine proteases together with proteoglycans and other immune effector molecules in large cytoplasmic granules. These serine proteases are collectively termed granzymes and include 4 distinct gene products: granzyme A, granzyme B, granzyme H, and the protein encoded by this gene, granzyme M. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
  Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.