CCDC103 (NM_001258397) Human Untagged Clone
CAT#: SC330678
CCDC103 (untagged) - Homo sapiens coiled-coil domain containing 103 (CCDC103), transcript variant 4
"NM_001258397" in other vectors (2)
Product Images
Other products for "CCDC103"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CCDC103 |
Synonyms | CILD17; PR46b; SMH |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001258397, the custom clone sequence may differ by one or more nucleotides
ATGGAAAGGAATGACATCATCAACTTCAAGGCTTTGGAGAAAGAGCTGCAGGCTGCACTCACTGCTGATG AGAAGTACAAACGGGAGAATGCTGCCAAGTTACGGGCAGTGGAACAGAGGGTGGCTTCCTATGAGGAGTT CAGGGGTATTGTCCTTGCATCACATCTGAAGCCACTGGAGCGGAAGGATAAGATGGGAGGAAAGAGAACT GTGCCCTGGAACTGTCACACTATTCAGGGAAGGACCTTCCAGGATGTGGCCACTGAAATCTCCCCGAACA GCTGGAAGAGCTCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258397 |
ORF Size | 297 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001258397.1, NP_001245326.1 |
RefSeq Size | 1813 |
RefSeq ORF | 297 |
Locus ID | 388389 |
Gene Summary | This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.