PAX6 (NM_001258462) Human Untagged Clone

CAT#: SC330686

PAX6 (untagged) - Homo sapiens paired box 6 (PAX6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PAX6
• Synonyms: AN; AN2; ASGD5; D11S812E; FVH1; MGDA; WAGR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001258462, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
  CCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCA
  GACCCATGCAGATGCAAAAGTCCAAGTGCTGGACAATCAAAACGTGTCCAACGGATGTGTGAGTAAAATT
  CTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAAACCGAGAGTAGCGA
  CTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGTGCCCGTCCATCTTTGCTTGGGAAATCCG
  AGACAGATTACTGTCCGAGGGGGTCTGTACCAACGATAACATACCAAGCGTGTCATCAATAAACAGAGTT
  CTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGTTGA
  ACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGTTGGTATCCGGGGACTTCGGTGCCAGGGCAACCTAC
  GCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATACCAACTCCATCAGTTCCAACGGAGAAGAT
  TCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAG
  AGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACT
  AGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGA
  AGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTA
  GTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTC
  CATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACC
  ATGGCAAATAACCTGCCTATGCAACCCCCAGTCCCCAGCCAGACCTCCTCATACTCCTGCATGCTGCCCA
  CCAGCCCTTCGGTGAATGGGCGGAGTTATGATACCTACACCCCCCCACATATGCAGACACACATGAACAG
  TCAGCCAATGGGCACCTCGGGCACCACTTCAACAGGACTCATTTCCCCTGGTGTGTCAGTTCCAGTTCAA
  GTTCCCGGAAGTGAACCTGATATGTCTCAATACTGGCCAAGATTACAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258462
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258462.1, NP_001245391.1
• RefSeq Size: 6925 bp
• RefSeq ORF: 1311 bp
• Locus ID: 5080
• Cytogenetics: 11p13
• Protein Families: Adult stem cells, Druggable Genome, Embryonic stem cells, Transcription Factors
• Protein Pathways: Maturity onset diabetes of the young
• Gene Summary: 'This gene encodes paired box protein Pax-6, one of many human homologs of the Drosophila melanogaster gene prd. In addition to a conserved paired box domain, a hallmark feature of this gene family, the encoded protein also contains a homeobox domain. Both domains are known to bind DNA and function as regulators of gene transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing results in multiple transcript variants encoding different isoforms. Interestingly, inclusion of a particular alternate coding exon has been shown to increase the length of the paired box domain and alter its DNA binding specificity. Consequently, isoforms that carry the shorter paired box domain regulate a different set of genes compared to the isoforms carrying the longer paired box domain. [provided by RefSeq, Mar 2019]'
  Transcript Variant: This variant (4) differs in the 5' UTR and includes an alternate in-frame exon in the 5' coding region, compared to variant 1. It initiates from the A (P0) promoter. The encoded isoform (b, also known as 5a) is longer than isoform a. Variants 2, 4, 5, 8, and 17-19 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.