Microsomal Glutathione S transferase 1 (MGST1) (NM_001260512) Human Untagged Clone
CAT#: SC330694
MGST1 (untagged) - Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant 6
"NM_001260512" in other vectors (2)
Product Images
Other products for "MGST1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MGST1 |
Synonyms | GST12; MGST; MGST-I |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001260512, the custom clone sequence may differ by one or more nucleotides
ATGGTTGACCTCACCCAGGTAATGGATGATGAAGTATTCATGGCTTTTGCATCCTATGCAACAATTATTC TTTCAAAAATGATGCTTATGAGTACTGCAACTGCATTCTATAGATTGACAAGAAAGGTTTTTGCCAATCC AGAAGACTGTGTAGCATTTGGCAAAGGAGAAAATGCCAAGAAGTATCTTCGAACAGATGACAGAGTAGAA CGTGTACGCAGTCATTGTAAAGCTGTTACGATTAGCATATTTGAACGGCAGAGCCAGAATGGGGCTACAA ATGAAGTGAAAAGTATGCTTTACCGTGTGCAACAATTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001260512 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001260512.1, NP_001247441.1 |
RefSeq Size | 1088 bp |
RefSeq ORF | 321 bp |
Locus ID | 4257 |
Cytogenetics | 12p12.3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
Gene Summary | 'The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]' Transcript Variant: This variant (6) differs in the 5' UTR and contains an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.