PSMD9 (NM_001261400) Human Untagged Clone

CAT#: SC330702

PSMD9 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (PSMD9), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMD9
• Synonyms: p27; Rpn4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261400, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTCC
  AGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGCGG
  TCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCATAAC
  ATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAAAAAC
  ACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCTCTGCA
  AAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001261400.1, NP_001248329.1
• RefSeq Size: 2053 bp
• RefSeq ORF: 357 bp
• Locus ID: 5715
• Cytogenetics: 12q24.31
• Gene Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]'
  Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.