Translin (TSN) (NM_001261401) Human Untagged Clone

CAT#: SC330703

TSN (untagged) - Homo sapiens translin (TSN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TSN
• Synonyms: BCLF-1; C3PO; RCHF1; REHF-1; TBRBP; TRSLN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261401, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGTGAGCGAGATCTTCGTGGAGCTGCAGGGCTTTTTGGCTGCCGAGCAGGACATCCGAGAGGAAA
  TCAGAAAAGTTGTACAGAGTTTAGAACAAACAGCTCGAGAGATTTTAACTCTACTGCAAGGGGTCCATCA
  GGGTGCTGGGTTTCAGGACATTCCAAAGAGGTGTTTGAAAGCTCGAGAACATTTTGGTACAGTAAAAACA
  CATCTAACATCTTTGAAGACCAAATTTCCTGCTGAACAGTATTACAGATTTCATGAGCACTGGAGGTTTG
  TGTTGCAGCGCTTGGTCTTCTTGGCAGCATTTGTTGTGTATTTGGAAACAGAAACACTAGTGACTCGAGA
  AGCAGTTACAGAAATTCTTGGCATCGAGGCTGTCTGTCAACAGCGTGACTGCTGGAGACTACTCCCGACC
  CCTCCACATCTCCACCTTCATCAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261401
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001261401.1, NP_001248330.1
• RefSeq Size: 3328 bp
• RefSeq ORF: 447 bp
• Locus ID: 7247
• Cytogenetics: 2q14.3
• Gene Summary: 'This gene encodes a DNA-binding protein which specifically recognizes conserved target sequences at the breakpoint junction of chromosomal translocations. Translin polypeptides form a multimeric structure that is responsible for its DNA-binding activity. Recombination-associated motifs and translin-binding sites are present at recombination hotspots and may serve as indicators of breakpoints in genes which are fused by translocations. These binding activities may play a crucial role in chromosomal translocation in lymphoid neoplasms. This protein encoded by this gene, when complexed with translin-associated protein X, also forms a Mg ion-dependent endoribonuclease that promotes RNA-induced silencing complex (RISC) activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]'
  Transcript Variant: This variant (2) lacks an exon in the 3' coding region, compared to variant 1, which results in a frameshift and a protein (isoform 2) with a shorter and distinct C-terminus, compared to isoform 1.