TXNRD1 (NM_001261445) Human Untagged Clone

CAT#: SC330713

TXNRD1 (untagged) - Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 6


  "NM_001261445" in other vectors (2)

Reconstitution Protocol

USD 570.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TXNRD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TXNRD1
Synonyms GRIM-12; TR; TR1; TRXR1; TXNR
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001261445, the custom clone sequence may differ by one or more nucleotides


ATGGAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGATCTGCCCGTTGTGT
TTGTGAAACAGAGAAAGATAGGCGGCCATGGTCCAACCTTGAAGGCTTATCAGGAGGGCAGACTTCAAAA
GCTACTAAAAATGAACGGCCCTGAAGATCTTCCCAAGTCCTATGACTATGACCTTATCATCATTGGAGGT
GGCTCAGGAGGTCTGGCAGCTGCTAAGGAGGCAGCCCAATATGGCAAGAAGGTGATGGTCCTGGACTTTG
TCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAATGTGGGTTGCATACCTAA
AAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTC
GAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATT
GGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCC
TCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCC
ACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTT
TCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGG
ATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAG
GACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATCAAGTTTATAAGACAGTTCGTACCAA
TTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGAGTAGTAGCTCAGTCCACCAATAGTGA
GGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATAGGAAGAGATGCTTGCACAAGAAAAATT
GGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGAAAAATACCTGTCACAGATGAAGAACAGA
CCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAGGATAAGGTGGAGCTCACCCCAGTTGCAAT
CCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGTTCCACTGTCAAGTGTGACTATGAAAATGTT
CCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGTGGCCTTTCTGAGGAGAAAGCTGTGGAGAAGT
TTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTTTGGCCATTGGAATGGACGATTCCGTCAAGAGA
TAACAACAAATGTTATGCAAAAATAATCTGTAATACTAAAGACAATGAACGTGTTGTGGGCTTTCACGTA
CTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTTGCAGCTGCGCTCAAATGTGGACTGACCAAAAAGC
AGCTGGACAGCACAATTGGAATCCACCCTGTCTGTGCAGAGGTATTCACAACATTGTCTGTGACCAAGCG
CTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGAGGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001261445
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001261445.1, NP_001248374.1
RefSeq Size 4291 bp
RefSeq ORF 1650 bp
Locus ID 7296
Cytogenetics 12q23.3
Protein Families Druggable Genome
Protein Pathways Pyrimidine metabolism
Gene Summary 'The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes an ubiquitously expressed, cytosolic form of TrxR, which functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing, primarily at the 5' end, results in transcript variants encoding same or different isoforms, including a glutaredoxin-containing isoform that is predominantly expressed in testis. [provided by RefSeq, May 2017]'
Transcript Variant: This variant (5) uses an alternate donor splice site at the 5' terminal exon, which results in translation initiation from an in-frame upstream start codon compared to variant 1. The encoded isoform (3) has a longer and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.