Neuronal membrane glycoprotein M6 a (GPM6A) (NM_001261448) Human Untagged Clone

CAT#: SC330715

GPM6A (untagged) - Homo sapiens glycoprotein M6A (GPM6A), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPM6A
• Synonyms: GPM6; M6A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261448, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGACCTGGAAGGGTGTTTTGAATGCTGTATCAAATGCCTGGGGGGCATTCCCTATGCCTCTCTGA
  TTGCCACCATCCTGCTCTATGCGGGTGTTGCCCTGTTCTGTGGCTGCGGTCATGAAGCGCTTTCTGGAAC
  TGTCAACATTCTGCAAACCTACTTTGAGATGGCAAGAACTGCTGGAGACACACTGGATGTTTTTACCATG
  ATTGACATCTTTAAGTATGTGATCTACGGCATCGCAGCTGCGTTCTTTGTGTATGGCATTTTGCTGATGG
  TGGAAGGTTTCTTCACAACTGGGGCCATCAAAGATCTCTATGGGGATTTCAAAATCACCACTTGTGGCAG
  ATGTGTGAGCGCTTGGTTCATTATGCTGACATATCTTTTCATGTTGGCCTGGCTGGGAGTCACGGCTTTC
  ACCTCACTGCCAGTTTACATGTACTTCAATCTGTGGACCATCTGCCGGAACACCACATTAGTGGAGGGAG
  CAAATCTCTGCTTGGACCTTCGTCAGTTTGGAATTGTGACAATTGGAGAGGAAAAGAAAATTTGTACTGT
  CTCTGAGAATTTCTTGAGGATGTGCGAATCTACTGAGCTGAACATGACCTTCCACTTGTTTATTGTGGCA
  CTTGCTGGAGCTGGGGCAGCAGTCATTGCTATGGTTCACTACCTTATGGTTCTGTCTGCCAACTGGGCCT
  ATGTGAAAGACGCCTGCCGGATGCAGAAGTATGAAGACATCAAGTCGAAGGAAGAGCAAGAGCTTCATGA
  CATCCACTCTACTCGCTCCAAAGAGCGGCTCAATGCATACACATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261448
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001261448.1, NP_001248377.1
• RefSeq Size: 3114 bp
• RefSeq ORF: 816 bp
• Locus ID: 2823
• Cytogenetics: 4q34.2
• Protein Families: Transmembrane
• Gene Summary: ''
  Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) is shorter and has a distinct N-terminus, compared to isoform 1.