UCK (UCK1) (NM_001261451) Human Untagged Clone

CAT#: SC330717

UCK1 (untagged) - Homo sapiens uridine-cytidine kinase 1 (UCK1), transcript variant 4


  "NM_001261451" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UCK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UCK1
Synonyms URK1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001261451, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCGGCGGGAGGCGAAGACTGCGAGAGCCCCGCGCCGGAGGCCGACCGTCCGCACCAGCGGCCCT
TCCTGATAGGGGACGAGCGGTTCCAGGCGGGAATCCCGCTTCTGTGTCTCCAGTCGACCGTGTGTGAGAA
GATCATGGAGTTGCTGGGACAGAACGAGGTGGAACAGCGGCAGCGGAAGGTGGTCATCCTGAGCCAGGAC
AGGTTCTACAAGGTCCTGACGGCAGAGCAGAAGGCCAAGGCCTTGAAAGGACAGTACAATTTTGACCATC
CAGATGCCTTTGATAATGATTTGATGCACAGGACTCTGAAGAACATCGTGGAGGGCAAAACGGTGGAGGT
GCCGACCTATGATTTTGTGACACACTCAAGGTTACCAGAGACCACGGTGGTCTACCCTGCGGACGTGGTT
CTGTTTGAGGGCATCTTGGTGTTCTACAGCCAGGAGATCCGGGACATGTTCCACCTGCGCCTCTTCGTGG
ACACCGACTCCGACGTCAGGCTGTCTCGAAGAGTTCTCCGGGACGTGCGCCGAGGGAGGGACCTGGAGCA
GATTCTGACGCAGTACACCACCTTCGTGAAGCCGGCCTTCGAGGAGTTCTGCCTGCCGACAAAGAAGTAT
GCCGATGTGATCATCCCGCGAGGAGTGGACAATATGGTTGCCATCAACCTGATCGTGCAGCACATCCAGG
ACATTCTGAATGGTGACATCTGCAAATGGCACCGAGGAGGGTCCAATGGGCGGAGCTACAAGCGGACCTT
TTCTGAGCCAGGGGACCACCCTGGGATGCTGACCTCTGGCAAACGGTCACATTTGGAGTCCAGCAGCAGA
CCCCACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001261451
ORF Size 849 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001261451.1, NP_001248380.1
RefSeq Size 2206
RefSeq ORF 849
Locus ID 83549
Protein Families Druggable Genome
Protein Pathways Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism
Gene Summary This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Transcript Variant: This variant (4) has multiple differences in the 5' coding region, compared to variant 1, that result in a protein (isoform d) with a longer N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.