URM1 (NM_001265582) Human Untagged Clone

CAT#: SC330735

URM1 (untagged) - Homo sapiens ubiquitin related modifier 1 (URM1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: URM1
• Synonyms: C9orf74
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001265582, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGCGCCCTTGTCAGTGGAGGTGGAGTTCGGAGGTGGTGCGGAGCTCCTGTTTGACGGTATTAAGA
  AACATCGAGTCACTTTGCCTGGACAGGAGGAACCCTGGGACATCCGGAACCTGCTCATCTGGATCAAGAA
  GAATTTGCTAAAAGAGCGGCCAGAGTTGTTCATCCAGGGAGACAGCGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001265582
• ORF Size: 192 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001265582.1, NP_001252511.1
• RefSeq Size: 4369
• RefSeq ORF: 192
• Locus ID: 81605