INSL3 (NM_001265587) Human Untagged Clone

CAT#: SC330736

INSL3 (untagged) - Homo sapiens insulin-like 3 (Leydig cell) (INSL3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: INSL3
• Synonyms: ley-I-L; RLF; RLNL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001265587, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCCCCGTCTGCCCGCCTGGGCGCTGGTGCTGCTGGGCCCTGCCCTGGTGTTCGCGTTGGGCCCCG
  CGCCCACCCCAGAGATGCGTGAGAAGTTGTGCGGCCACCACTTCGTACGCGCGCTAGTGCGCGTGTGCGG
  GGGCCCCCGCTGGTCCACCGAAGCCAGGAGGCCTGCGACCGGAGGCGACCAGAGGGAGTCTCACTCTGTT
  TCCCAGGCTGGTCTCAAACTCCTGAGCTCAAGTAATCCTCCCACCTTGACCTTCCAAAGTGTTGGGATTA
  GCGATGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTC
  ACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACCGCCACCACCGTGCAGCTGCCA
  CCAACCCTGCACGCTACTGCTGCCTCAGTGGCTGTACCCAACAAGACCTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001265587
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001265587.1, NP_001252516.1
• RefSeq Size: 928 bp
• RefSeq ORF: 474 bp
• Locus ID: 3640
• Cytogenetics: 19p13.11
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.