PFD6 (PFDN6) (NM_001265595) Human Untagged Clone

CAT#: SC330737

PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 3


  "NM_001265595" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFDN6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFDN6
Synonyms H2-KE2; HKE2; KE-2; PFD6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001265595, the custom clone sequence may differ by one or more nucleotides


ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTAA
GTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAACT
GGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTGGGG
GAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCCCAGC
TTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTCCAGCG
GGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001265595
ORF Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001265595.1, NP_001252524.1
RefSeq Size 597
RefSeq ORF 390
Locus ID 10471
Protein Families Stem cell - Pluripotency
Gene Summary PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]). [supplied by OMIM, Jul 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.