PFD6 (PFDN6) (NM_001265595) Human Untagged Clone
CAT#: SC330737
PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 3
"NM_001265595" in other vectors (2)
Product Images
Other products for "PFDN6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PFDN6 |
Synonyms | H2-KE2; HKE2; KE-2; PFD6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001265595, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTAA GTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAACT GGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTGGGG GAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCCCAGC TTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTCCAGCG GGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001265595 |
ORF Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001265595.1, NP_001252524.1 |
RefSeq Size | 597 |
RefSeq ORF | 390 |
Locus ID | 10471 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]). [supplied by OMIM, Jul 2010] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.