PSME3 (NM_001267045) Human Untagged Clone

CAT#: SC330746

PSME3 (untagged) - Homo sapiens proteasome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) (PSME3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSME3
• Synonyms: HEL-S-283; Ki; PA28-gamma; PA28G; PA28gamma; REG-GAMMA
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267045, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAAAATGGATCCTCAAAAAAATAAAGTATTTGCAGTCTGGGGGCCTCTCAGCTTCTTATTACAGTT
  ACAAGGTTGATTCTTTCAGGGAGCGGATCACAAGTGAGGCAGAAGACTTGGTGGCAAATTTTTTCCCAAA
  GAAGTTATTAGAACTTGATAGTTTTCTGAAGGAACCAATCTTAAACATCCATGACCTAACTCAGATCCAC
  TCTGACATGAATCTCCCAGTCCCTGACCCCATTCTTCTCACCAATAGCCATGATGGACTGGATGGTCCCA
  CTTATAAGAAGCGAAGGTTGGATGAGTGTGAAGAAGCCTTCCAAGGAACCAAGGTGTTTGTGATGCCCAA
  TGGGATGCTGAAAAGCAACCAGCAGCTGGTGGACATTATTGAGAAAGTGAAACCTGAGATCCGGCTGTTG
  ATTGAGAAATGTAACACGGTCAAAATGTGGGTACAGCTCCTGATTCCCAGGATAGAAGATGGAAACAACT
  TTGGGGTGTCCATTCAGGAGGAAACAGTTGCAGAGCTAAGAACTGTTGAGAGTGAAGCTGCATCTTATCT
  GGACCAGATTTCTAGATATTATATTACAAGAGCCAAATTGGTTTCTAAAATAGCTAAATATCCCCATGTG
  GAGGACTATCGCCGCACCGTGACAGAGATTGATGAGAAAGAATATATCAGCCTTCGGCTCATCATATCAG
  AGCTGAGGAATCAATATGTCACTCTACATGACATGATCCTGAAAAATATCGAGAAGATCAAACGGCCCCG
  GAGCAGCAATGCAGAGACTCTGTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267045
• ORF Size: 798 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267045.1, NP_001253974.1
• RefSeq Size: 3782
• RefSeq ORF: 798
• Locus ID: 10197
• Protein Families: Stem cell - Pluripotency
• Protein Pathways: Antigen processing and presentation, Proteasome
• Gene Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.