CREM (NM_001267567) Human Untagged Clone

CAT#: SC330763

CREM (untagged) - Homo sapiens cAMP responsive element modulator (CREM), transcript variant 28


  "NM_001267567" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CREM"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CREM
Synonyms CREM-2; hCREM-2; ICER
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001267567, the custom clone sequence may differ by one or more nucleotides


ATGACAAATTCAGGAGCTCCTCCACCAGGTGCTACAATTGTACAGTACGCAGCACAATCAGCTGATGGCA
CACAGCAGTTCTTTGTCCCAGGCAGCCAGGTTGTTGTTCAAGCTGCCACTGGTGACATGCCAACTTACCA
GATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTGCACAGT
CCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACAGGGAAGCTGCCA
AAGAATGTCGACGTCGAAAGAAAGAATATGTAAAATGTCTGGAGAGCCGAGTTGCAGTGCTGGAAGTCCA
GAACAAGAAGCTTATAGAGGAACTTGAAACCTTGAAAGACATTTGTTCTCCCAAAACAGATTACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001267567
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001267567.1, NP_001254496.1
RefSeq Size 1773 bp
RefSeq ORF 417 bp
Locus ID 1390
Cytogenetics 10p11.21
Protein Families Druggable Genome, Transcription Factors
Gene Summary 'This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (28) has an alternate first exon in place of the first five exons compared to variant 1. The resulting isoform (28) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.