IFT20 (NM_001267776) Human Untagged Clone

CAT#: SC330786

IFT20 (untagged) - Homo sapiens intraflagellar transport 20 homolog (Chlamydomonas) (IFT20), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IFT20
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267776, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAAGGACATCCTGGGTGAAGCAGGGCTACACTTTGATGAACTGAACAAGCTGAGGGTGTTGGACC
  CAGAGGTTACCCAGCAGACCATAGAGCTGAAGGAAGAGTGCAAAGACTTTGTGGACAAAATTGGCCAGTT
  TCAGAAAATAGTTGGTGGTTTAATTGAGCTTGTTGATCAACTTGCAAAAGAAGCAGAAAATGAAAAGATG
  AAGGCCATCGGTGCTCGGAACTTGCTCAAATCTATAGCAAAGCAGAGAGAAGCTCAACAGCAGCAACTTC
  AAGCCCTAATAGCAGAAAAGAAAATGCAGCTAGAAAGGTATCGGGTTGAATATGAAGCTTTGTGTAAAGT
  AGAAGCAGAACAAAATGAATTTATTGACCAATTTATTTTTCAGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267776
• ORF Size: 399 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267776.1, NP_001254705.1
• RefSeq Size: 888
• RefSeq ORF: 399
• Locus ID: 90410
• Gene Summary: This gene encodes a intraflagellar transport protein important for intracellular transport. The encoded protein forms part of a complex involved in trafficking of proteins from the Golgi body, including recycling of immune signalling components (Finetti et al., PubMed: 19855387). This gene is part of a complex set of sense-antisense loci that may be co-regulated. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Jun 2012]
  Transcript Variant: This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a shorter N-terminus compared to isoform 1.