BORIS (CTCFL) (NM_001269055) Human Untagged Clone
CAT#: SC330806
CTCFL (untagged) - Homo sapiens CCCTC-binding factor (zinc finger protein)-like (CTCFL), transcript variant 16
"NM_001269055" in other vectors (2)
Product Images
Other products for "CTCFL"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CTCFL |
Synonyms | BORIS; CT27; CTCF-T; dJ579F20.2; HMGB1L1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001269055, the custom clone sequence may differ by one or more nucleotides
ATGTTCACCTCTTCTAGAATGTCAAGTTTTAATCGTCATATGAAAACTCACACCAGTGAGAAGCCTCACC TGTGTCACCTCTGCCTGAAAACCTTCCGTACGGTCACTCTGCTGCGGAACCATGTTAACACCCACACAGG AACCAGGCCCTACAAGTGTAACGACTGCAACATGGCATTTGTCACCAGTGGAGAACTCGTCCGACACAGG CGCTATAAACATACTCATGAGAAACCCTTTAAATGTTCCATGTGCAAGTATGCCAGTGTGGAGGCAAGTA AATTGAAGCGCCATGTCCGATCCCACACTGGGGAGCGCCCCTTTCAGTGTTGCCAGTGCAGCTATGCCAG CAGAGATACCTACAAGCTGAAACGCCACATGAGAACGCACTCAGGTGAGAAGCCTTACGAATGCCACATC TGCCACACCCGCTTCACCCAGAGCGGGACCATGAAAATACATATTCTGCAGAAACACGGCGAAAATGTCC CCAAATACCAGTGTCCCCATTGTGCCACCATCATTGCACGGAAAAGCGACCTACGTGTGCATATGCGCAA CTTGCATGCTTACAGCGCTGCAGAGCTGAAATGCCGCTACTGTTCTGCTGTCTTCCATGAACGCTATGCC CTCATTCAGCACCAGAAAACTCATAAGAATGAGAAGAGGTTCAAGTGCAAACACTGCAGTTATGCCTGCA AGCAGGAACGTCATATGACCGCTCACATTCGTACCCACACTGGAGAGAAACCATTCACCTGCCTTTCTTG CAATAAATGTTTCCGACAGAAGCAACTTCTAAACGCTCACTTCAGGAAATACCACGATGCAAATTTCATC CCGACTGTTTACAAATGCTCCAAGTGTGGCAAAGGCTTTTCCCGCTGGGTGTTGTATTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001269055 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001269055.1, NP_001255984.1 |
RefSeq Size | 2175 |
RefSeq ORF | 900 |
Locus ID | 140690 |
Protein Families | Transcription Factors |
Gene Summary | CCCTC-binding factor (CTCF), an 11-zinc-finger factor involved in gene regulation, utilizes different zinc fingers to bind varying DNA target sites. CTCF forms methylation-sensitive insulators that regulate X-chromosome inactivation. This gene is a paralog of CTCF and appears to be expressed primarily in the cytoplasm of spermatocytes, unlike CTCF which is expressed primarily in the nucleus of somatic cells. CTCF and the protein encoded by this gene are normally expressed in a mutually exclusive pattern that correlates with resetting of methylation marks during male germ cell differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (16, also known as B5) differs in the 5' and 3' UTRs and has multiple differences in the coding region, compared to variant 1. The resulting isoform (13) has a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.