hHR23A (RAD23A) (NM_001270362) Human Untagged Clone

CAT#: SC330807

RAD23A (untagged) - Homo sapiens RAD23 homolog A (S. cerevisiae) (RAD23A), transcript variant 2


  "NM_001270362" in other vectors (2)

Reconstitution Protocol

USD 370.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAD23A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAD23A
Synonyms HHR23A; HR23A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270362, the custom clone sequence may differ by one or more nucleotides


ATGGCCGTCACCATCACGCTCAAAACGCTGCAGCAGCAGACCTTCAAGATCCGCATGGAGCCTGACGAGA
CGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGTCGTGATGCCTTCCCCGTGGCTGGACAGAA
ACTCATCTATGCCGGCAAGATCTTGAGTGACGATGTCCCTATCAGGGACTATCGCATCGATGAGAAGAAC
TTTGTGGTCGTCATGGTGACCAAGACCAAAGCCGGCCAGGGTACCTCAGCACCCCCAGAGGCCTCACCCA
CAGCTGCCCCAGAGTCCTCTACATCCTTCCCGCCTGCCCCCACCTCAGGCATGTCCCATCCCCCACCTGC
CGCCAGAGAGGACAAGAGCCCATCAGAGGAATCCGCCCCCACGACGTCCCCAGAGTCTGTGTCAGGCTCT
GTTCCCTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACGCTAGTGACGGGCTCTGAGTATG
AGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGAGAGCGGGTCGTGGCCGCCCTGAGAGCCAG
CTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGGAATTCCTGGGAGCCCCGAGCCGGAACAC
GGTTCTGTCCAGGAGAGCCAGGTATCGGAGCAGCCGGCCACGGAAGCAGGAGAGAACCCCCTGGAGTTCC
TGCGGGACCAGCCCCAGTTCCAGAACATGCGGCAGGTGATTCAGCAGAACCCTGCGCTGCTGCCCGCCCT
GCTCCAGCAGCTGGGCCAGGAGAACCCTCAGCTTTTACAGCAAATCAGCCGGCACCAGGAGCAGTTCATC
CAGATGCTGAACGAGCCCCCTGGGGAGCTGGCGGACATCTCAGATGTGGAGGGGGAGGTGGGCGCCATAG
GAGAGGAGGCCCCGCAGATGAACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAGAGGTTGAA
GGCCCTGGGCTTCCCAGAGAGCCTGGTCATCCAGGCCTATTTCGCGTGTGAAAAAAATGAGAACTTGGCT
GCCAACTTCCTCCTGAGTCAGAACTTTGATGACGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270362
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270362.1, NP_001257291.1
RefSeq Size 1818 bp
RefSeq ORF 1089 bp
Locus ID 5886
Cytogenetics 19p13.13
Protein Families Druggable Genome
Protein Pathways Nucleotide excision repair
Gene Summary 'The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.