glucose 6 phosphatase, catalytic subunit (G6PC) (NM_001270397) Human Untagged Clone

CAT#: SC330823

G6PC (untagged) - Homo sapiens glucose-6-phosphatase, catalytic subunit (G6PC), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: G6PC
• Synonyms: G6Pase; G6PC1; G6PT; GSD1; GSD1a
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270397, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGAAGGAATGAATGTTCTCCATGACTTTGGGATCCAGTCAACACATTACCTCCAGGTGAATTACC
  AAGACTCCCAGGACTGGTTCATCTTGGTGTCCGTGATCGCAGACCTCAGGAATGCCTTCTACGTCCTCTT
  CCCCATCTGGTTCCATCTTCAGGAAGCTGTGGGCATTAAACTCCTTTGGGTAGCTGTGATTGGAGACTGG
  CTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACAGCGTCCATACTGGTGGGTTTTGGATACTGACTACT
  ACAGCAACACTTCCGTGCCCCTGATAAAGCAGTTCCCTGTAACCTGTGAGACTGGACCAGGGAAAGATAA
  AGCCGACCTACAGATTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGGCTGTGCAGCTGAATGT
  CTGTCTGTCACGAATCTACCTTGCTGCTCATTTTCCTCATCAAGTTGTTGCTGGAGTCCTGTCAGGCATT
  GCTGTTGCAGAAACTTTCAGCCACATCCACAGCATCTATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270397
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270397.1, NP_001257326.1
• RefSeq Size: 4092 bp
• RefSeq ORF: 531 bp
• Locus ID: 2538
• Cytogenetics: 17q21.31
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Adipocytokine signaling pathway, Galactose metabolism, Glycolysis / Gluconeogenesis, Insulin signaling pathway, Metabolic pathways, Starch and sucrose metabolism
• Gene Summary: 'Glucose-6-phosphatase (G6Pase) is a multi-subunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for G6P, inorganic phosphate, and glucose. This gene (G6PC) is one of the three glucose-6-phosphatase catalytic-subunit-encoding genes in human: G6PC, G6PC2 and G6PC3. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). This disease, also known as von Gierke disease, is a metabolic disorder characterized by severe hypoglycemia associated with the accumulation of glycogen and fat in the liver and kidneys.[provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (2) lacks an internal segment in the coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.