KCNE1 (NM_001270404) Human Untagged Clone

CAT#: SC330826

KCNE1 (untagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 7


  "NM_001270404" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNE1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNE1
Synonyms ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270404, the custom clone sequence may differ by one or more nucleotides


ATGATCCTGTCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACAGTTCAGCAGG
GTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGCAAGCTGGAGGCCCTCTACGT
CCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGCATCATGCTGAGCTACATCCGCTCCAAGAAG
CTGGAGCACTCGAACGACCCATTCAACGTCTACATCGAGTCCGATGCCTGGCAAGAGAAGGACAAGGCCT
ATGTCCAGGCCCGGGTCCTGGAGAGCTACAGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATAGAACA
ACCCAACACACACCTTCCTGAGACGAAGCCTTCCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001270404
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270404.1, NP_001257333.1
RefSeq Size 3239 bp
RefSeq ORF 390 bp
Locus ID 3753
Cytogenetics 21q22.12
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (7) differs in the 5' UTR, compared to variant 2. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.