KCNE1 (NM_001270405) Human Untagged Clone
CAT#: SC330827
KCNE1 (untagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8
"NM_001270405" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNE1 |
Synonyms | ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001270405, the custom clone sequence may differ by one or more nucleotides
ATGATCCTGTCTAACACCACAGCGGTGACGCCCTTTCTGACCAAGCTGTGGCAGGAGACAGTTCAGCAGG GTGGCAACATGTCGGGCCTGGCCCGCAGGTCCCCCCGCAGCAGTGACGGCAAGCTGGAGGCCCTCTACGT CCTCATGGTACTGGGATTCTTCGGCTTCTTCACCCTGGGCATCATGCTGAGCTACATCCGCTCCAAGAAG CTGGAGCACTCGAACGACCCATTCAACGTCTACATCGAGTCCGATGCCTGGCAAGAGAAGGACAAGGCCT ATGTCCAGGCCCGGGTCCTGGAGAGCTACAGGTCGTGCTATGTCGTTGAAAACCATCTGGCCATAGAACA ACCCAACACACACCTTCCTGAGACGAAGCCTTCCCCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270405 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270405.1, NP_001257334.1 |
RefSeq Size | 3151 bp |
RefSeq ORF | 390 bp |
Locus ID | 3753 |
Cytogenetics | 21q22.12 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Gene Summary | 'The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (8) differs in the 5' UTR, compared to variant 2. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231748 | KCNE1 (Myc-DDK tagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8 |
USD 420.00 |
|
RG231748 | KCNE1 (GFP-tagged) - Homo sapiens potassium voltage-gated channel, Isk-related family, member 1 (KCNE1), transcript variant 8 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review