PSMD5 (NM_001270427) Human Untagged Clone

CAT#: SC330831

PSMD5 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (PSMD5), transcript variant 2


  "NM_001270427" in other vectors (2)

Reconstitution Protocol

USD 470.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMD5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMD5
Synonyms S5B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270427, the custom clone sequence may differ by one or more nucleotides


ATGGCAGCCCAGGCTTTGGCGCTGCTGAGAGAGGTAGCGAGGCTGGAAGCGCCGCTGGAGGAGCTACGCG
CGCTTCACTCCGTGCTGCAGGCAGTGCCGCTCAACGAGCTTCGCCAGCAAGCGGCGGAGCTGCGCCTCGG
CCCGCTCTTCTCCCTGCTTAACGAGAACCATAGGGAAAAGACTACTTTGTGTGTATCCATTCTGGAGAGA
TTGCTCCAAGCTATGGAACCGGTTCACGTGGCCCGGAACCTCAGGGTTGACCTGCAGAGGGGACTAATTC
ACCCTGATGATTCTGTAAAAATCCTCACTCTTTCCCAGATTGGAAGAATTGTTGAAAATTCTGATGCTGT
TACTGAGATTCTAAATAATGCTGAATTACTAAAACAAATTGTTTATTGCATTGGTGGAGAGAATCTATCT
GTAGCAAAAGCGCTAATTATAGAGATTTCTTCCGTGTCACCAGAATCTTTAAACTACTGTACCACAAGTG
GATTGGTAACCCAGCTCCTGAGAGAGCTGACTGGTGAGGATGTGTTGGTCAGAGCCACCTGTATAGAAAT
GGTGACATCACTGGCATATACTCATCATGGGCGACAATATCTTGCTCAAGAAGGAGTAATTGACCAAATT
TCTAATATAATTGTTGGGGCAGATTCAGACCCTTTCTCTAGCTTCTATCTGCCAGGATTCGTGAAGTTTT
TTGGAAACCTGGCTGTCATGGATAGTCCTCAACAGATCTGTGAGCGTTATCCTATCTTTGTGGAAAAAGT
CTTTGAAATGATAGAAAGTCAGGACCCCACTATGATTGGTGTAGCTGTAGACACAGTTGGAATCTTGGGA
TCCAATGTTGAAGGAAAACAGGTTTTACAGAAAACAGGAACTCGCTTTGAACGCTTGCTTATGAGAATAG
GACATCAATCAAAGAATGCCCCAGTGGAGCTAAAAATTAGATGTTTGGATGCAATTTCATCTCTTCTGTA
CTTACCACCTGAGCAGCAGACTGATGACCTTCTGAGGATGACAGAATCCTGGTTTTCTTCTTTATCTCGG
GATCCACTGGAGCTCTTCCGTGGCATTAGTAGTCAGCCCTTCCCTGAACTACACTGTGCTGCCTTAAAAG
TGTTTACGGCCATTGCAAACCAACCCTGGGCTCAGAAACTTATGTTTAACAGTCCAGGTTTTGTAGAATA
TGTGGTGGACCGGTCTGTGGAGCATGACAAAGCTTCAAAGGATGCCAAATATGAACTAGTGAAAGCACTT
GCCAATTCCAAGACAATTGCAGAAATCTTTGGGAACCCAAATTATTTGAGGCTCAGAACTTACCTGAGTG
AAGGGCCATACTATGTGAAACCTGTTTCCACGACAGCAGTAGAAGGAGCCGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001270427
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270427.1, NP_001257356.1
RefSeq Size 3375 bp
RefSeq ORF 1386 bp
Locus ID 5711
Cytogenetics 9q33.2
Gene Summary 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly. [provided by RefSeq, Jul 2012]'
Transcript Variant: This variant (2) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.