CDK2AP1 (NM_001270433) Human Untagged Clone

CAT#: SC330833

CDK2AP1 (untagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2


  "NM_001270433" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDK2AP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CDK2AP1
Synonyms doc-1; DOC1; DORC1; p12DOC-1; ST19
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270433, the custom clone sequence may differ by one or more nucleotides


ATGGCAACGTCTTCACAGTACCGCCAGCTGCTCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAGG
GAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAAGAGCTGGGGAA
GGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTGAAGCGCGGCATCATTCACGCT
AGAGGACTGGTTCGGGAGTGCTTGGCAGAAACGGAACGGAATGCCAGATCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270433
ORF Size 264 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270433.1, NP_001257362.1
RefSeq Size 1136
RefSeq ORF 264
Locus ID 8099
Gene Summary The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region and represents the use of an alternate promoter, compared to variant 1. This difference results in the use of an in-frame downstream start codon and a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.