CDK2AP1 (NM_001270433) Human Untagged Clone
CAT#: SC330833
CDK2AP1 (untagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2
"NM_001270433" in other vectors (2)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CDK2AP1 |
| Synonyms | doc-1; DOC1; DORC1; p12DOC-1; ST19 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001270433, the custom clone sequence may differ by one or more nucleotides
ATGGCAACGTCTTCACAGTACCGCCAGCTGCTCAGTGACTACGGGCCACCGTCCCTAGGCTACACCCAGG GAACTGGGAACAGCCAGGTGCCCCAAAGCAAATACGCGGAGCTGCTGGCCATCATTGAAGAGCTGGGGAA GGAGATCAGACCCACGTACGCAGGGAGCAAGAGTGCCATGGAGAGGCTGAAGCGCGGCATCATTCACGCT AGAGGACTGGTTCGGGAGTGCTTGGCAGAAACGGAACGGAATGCCAGATCCTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001270433 |
| ORF Size | 264 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001270433.1, NP_001257362.1 |
| RefSeq Size | 1136 |
| RefSeq ORF | 264 |
| Locus ID | 8099 |
| Gene Summary | The protein encoded by this gene is a cyclin-dependent kinase 2 (CDK2) -associated protein which is thought to negatively regulate CDK2 activity by sequestering monomeric CDK2, and targeting CDK2 for proteolysis. This protein was found to also interact with DNA polymerase alpha/primase and mediate the phosphorylation of the large p180 subunit, which suggests a regulatory role in DNA replication during the S-phase of the cell cycle. This protein also forms a core subunit of the nucleosome remodeling and histone deacetylation (NURD) complex that epigenetically regulates embryonic stem cell differentiation. This gene thus plays a role in both cell-cycle and epigenetic regulation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) differs in the 5' UTR and coding region and represents the use of an alternate promoter, compared to variant 1. This difference results in the use of an in-frame downstream start codon and a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC231592 | CDK2AP1 (Myc-DDK tagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2 |
USD 420.00 |
|
| RG231592 | CDK2AP1 (GFP-tagged) - Homo sapiens cyclin-dependent kinase 2 associated protein 1 (CDK2AP1), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China