T (NM_001270484) Human Untagged Clone

CAT#: SC330850

T (untagged) - Homo sapiens T, brachyury homolog (mouse) (T), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TBXT
• Synonyms: SAVA; T; TFT
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270484, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTCCCCTGGCACCGAGAGCGCGGGAAAGAGCCTGCAGTACCGAGTGGACCACCTGCTGAGCGCCG
  TGGAGAATGAGCTGCAGGCGGGCAGCGAGAAGGGCGACCCCACAGAGCGCGAACTGCGCGTGGGCCTGGA
  GGAGAGCGAGCTGTGGCTGCGCTTCAAGGAGCTCACCAATGAGATGATCGTGACCAAGAACGGCAGGAGG
  ATGTTTCCGGTGCTGAAGGTGAACGTGTCTGGCCTGGACCCCAACGCCATGTACTCCTTCCTGCTGGACT
  TCGTGGCGGCGGACAACCACCGCTGGAAGTACGTGAACGGGGAATGGGTGCCGGGGGGCAAGCCGGAGCC
  GCAGGCGCCCAGCTGCGTCTACATCCACCCCGACTCGCCCAACTTCGGGGCCCACTGGATGAAGGCTCCC
  GTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGC
  ATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTT
  CCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTAC
  AATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCG
  GAGACAGCCAGCAACCTGGGTACTCCCAATCCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCA
  ATCCCATGACAATTGGTCCAGCCTTGGAATGCCTGCCCATCCCAGCATGCTCCCCGTGAGCCACAATGCC
  AGCCCACCTACCAGCTCCAGTCAGTACCCCAGCCTGTGGTCTGTGAGCAACGGCGCCGTCACCCCGGGCT
  CCCAGGCAGCAGCCGTGTCCAACGGGCTGGGGGCCCAGTTCTTCCGGGGCTCCCCCGCGCACTACACACC
  CCTCACCCATCCGGTCTCGGCGCCCTCTTCCTCGGGATCCCCACTGTACGAAGGGGCGGCCGCGGCCACA
  GACATCGTGGACAGCCAGTACGACGCCGCAGCCCAAGGCCGCCTCATAGCCTCATGGACACCTGTGTCGC
  CACCTTCCATGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270484
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001270484.1, NP_001257413.1
• RefSeq Size: 2233 bp
• RefSeq ORF: 1134 bp
• Locus ID: 6862
• Cytogenetics: 6q27
• Protein Families: ES Cell Differentiation/IPS, Transcription Factors
• Gene Summary: 'The protein encoded by this gene is an embryonic nuclear transcription factor that binds to a specific DNA element, the palindromic T-site. It binds through a region in its N-terminus, called the T-box, and effects transcription of genes required for mesoderm formation and differentiation. The protein is localized to notochord-derived cells. Variation in this gene was associated with susceptibility to neural tube defects and chordoma. A mutation in this gene was found in a family with sacral agenesis with vertebral anomalies. [provided by RefSeq, Sep 2018]'
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.