RPL13A (NM_001270491) Human Untagged Clone

CAT#: SC330852

RPL13A (untagged) - Homo sapiens ribosomal protein L13a (RPL13A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL13A
• Synonyms: L13A; TSTA1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270491, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACACCAACCCTTCCCGAGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGC
  GAGGTATGCTGCCCCACAAAACCAAGCGAGGCCAGGCCGCTCTGGACCGTCTCAAGGTGTTTGACGGCAT
  CCCACCGCCCTACGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTCGTGCGTCTGAAGCCT
  ACAAGAAAGTTTGCCTATCTGGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCA
  CCCTGGAGGAGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGAGGCTACG
  GAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATACACAGAGGTCCTCAAGACCCACGGACTC
  CTGGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270491
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270491.1, NP_001257420.1
• RefSeq Size: 1120
• RefSeq ORF: 429
• Locus ID: 23521
• Protein Pathways: Ribosome
• Gene Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (2) lacks an internal exon, uses an alternate splice site and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.