Granzyme H (GZMH) (NM_001270781) Human Untagged Clone

CAT#: SC330878

GZMH (untagged) - Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) (GZMH), transcript variant 3


  "NM_001270781" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GZMH"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GZMH
Synonyms CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270781, the custom clone sequence may differ by one or more nucleotides


ATGCAGCCATTCCTCCTCCTGTTGGCCTTTCTTCTGACCCCTGGGGCTGGGACAGAGGAGATCATCGGGG
GCCATGAGGCCAAGCCCCACTCCCGCCCCTACATGGCCTTTGTTCAGTTTCTGCAAGAGAAGAGTCGGAA
GAGGTGTGGCGGCATCCTAGTGAGAAAGGACTTTGTGCTGACAGCTGCTCACTGCCAGGGAAGCTCCATA
AATGTCACCTTGGGGGCCCACAATATCAAGGAACAGGAGCGGACCCAGCAGTTTATCCCTGTGAAAAGAC
CCATCCCCCATCCAGCCTATAATCCTAAGAACTTCTCCAACGACATCATGCTACTGCAGGGGGACTCCGG
GGGGCCCCTCGTGTGTAAGGACGTAGCCCAAGGTATTCTCTCCTATGGAAACAAAAAAGGGACACCTCCA
GGAGTCTACATCAAGGTCTCACACTTCCTGCCCTGGATAAAGAGAACAATGAAGCGCCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270781
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270781.1, NP_001257710.1
RefSeq Size 729 bp
RefSeq ORF 483 bp
Locus ID 2999
Cytogenetics 14q12
Protein Families Druggable Genome, Protease
Gene Summary 'This gene encodes a member of the peptidase S1 family of serine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a chymotrypsin-like protease. This protein is reported to be constitutively expressed in the NK (natural killer) cells of the immune system and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. This gene is present in a gene cluster with another member of the granzyme subfamily on chromosome 14. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter than isoform 1. This isoform (3) may undergo proteolytic processing similar to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.