CRIP2 (NM_001270841) Human Untagged Clone

CAT#: SC330879

CRIP2 (untagged) - Homo sapiens cysteine-rich protein 2 (CRIP2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CRIP2
• Synonyms: CRIP; CRP2; ESP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270841, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTCCAAATGCCCCAAGTGCGACAAGACCGTGTACTTCGCTGAGAAGGTGACGTCTCTGGGCAAGG
  ATTGGCACCGGCCCTGCCTGCGCTGCGAGCGCTGCGGGAAGACACTGACCCCCGGCGGGCACGCGGAGCA
  CGACGGCCAGCCCTACTGCCACAAGCCCTGCTATGGAATCCTCTTCGGACCCAAGGGAGTGAACACCGGT
  GCGGTGGGCAGCTACATCTATGACCGGGACCCCGAAGGCAAGGTCCAGCCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270841
• ORF Size: 264 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270841.1, NP_001257770.1
• RefSeq Size: 884
• RefSeq ORF: 264
• Locus ID: 1397
• Gene Summary: This gene encodes a putative transcription factor with two LIM zinc-binding domains. The encoded protein may participate in the differentiation of smooth muscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) lacks multiple exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.