BRP44L (MPC1) (NM_001270879) Human Untagged Clone

CAT#: SC330880

MPC1 (untagged) - Homo sapiens mitochondrial pyruvate carrier 1 (MPC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MPC1
• Synonyms: BRP44L; CGI-129; MPYCD; SLC54A1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270879, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAAAGTCTCCAGAGATTATCAGTGGGCGGATGACATTTGCCCTCTGTTGCTATTCTTTGACATTCA
  TGAGATTTGCCTACAAGGTACAGCCTCGGAACTGGCTTCTGTTTGCATGCCACGCAACAAATGAAGTAGC
  CCAGCTCATCCAGGGAGGGCGGCTTATCAAACACGAGATGACTAAAACGGCATCTGCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270879
• ORF Size: 201 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270879.1, NP_001257808.1
• RefSeq Size: 1193
• RefSeq ORF: 201
• Locus ID: 51660
• Gene Summary: The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (2) contains an alternate exon compared to variant 1. This results in a distinct 5' UTR and causes translation initiation at a downstream start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.