IFIT1 (NM_001270928) Human Untagged Clone

CAT#: SC330892

IFIT1 (untagged) - Homo sapiens interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), transcript variant 3


  "NM_001270928" in other vectors (2)

Reconstitution Protocol

USD 450.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IFIT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IFIT1
Synonyms C56; G10P1; IFI-56; IFI-56K; IFI56; IFIT-1; IFNAI1; ISG56; P56; RNM561
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270928, the custom clone sequence may differ by one or more nucleotides


ATGCCTGATTTAGAAAACAGAGTCTTGGATCAGATTGAATTCCTAGACACCAAATACAGTGTGGGAATAC
ACAACCTACTAGCCTATGTGAAACACCTGAAAGGCCAGAATGAGGAAGCCCTGAAGAGCTTAAAAGAAGC
TGAAAACTTAATGCAGGAAGAACATGACAACCAAGCAAATGTGAGGAGTCTGGTGACCTGGGGCAACTTT
GCCTGGATGTATTACCACATGGGCAGACTGGCAGAAGCCCAGACTTACCTGGACAAGGTGGAGAACATTT
GCAAGAAGCTTTCAAATCCCTTCCGCTATAGAATGGAGTGTCCAGAAATAGACTGTGAGGAAGGATGGGC
CTTGCTGAAGTGTGGAGGAAAAAATTATGAACGGGCCAAGGCCTGCTTTGAAAAGGTGCTTGAAGTGGAC
CCTGAAAACCCTGAATCCAGCGCTGGGTATGCGATCTCTGCCTATCGCCTGGATGGCTTTAAATTAGCCA
CAAAAAATCACAAGCCATTTTCTTTGCTTCCCCTAAGGCAGGCTGTCCGCTTAAATCCAGACAATGGATA
TATTAAGGTTCTCCTTGCCCTGAAGCTTCAGGATGAAGGACAGGAAGCTGAAGGAGAAAAGTACATTGAA
GAAGCTCTAGCCAACATGTCCTCACAGACCTATGTCTTTCGATATGCAGCCAAGTTTTACCGAAGAAAAG
GCTCTGTGGATAAAGCTCTTGAGTTATTAAAAAAGGCCTTGCAGGAAACACCCACTTCTGTCTTACTGCA
TCACCAGATAGGGCTTTGCTACAAGGCACAAATGATCCAAATCAAGGAGGCTACAAAAGGGCAGCCTAGA
GGGCAGAACAGAGAAAAGCTAGACAAAATGATAAGATCAGCCATATTTCATTTTGAATCTGCAGTGGAAA
AAAAGCCCACATTTGAGGTGGCTCATCTAGACCTGGCAAGAATGTATATAGAAGCAGGCAATCACAGAAA
AGCTGAAGAGAATTTTCAAAAATTGTTATGCATGAAACCAGTGGTAGAAGAAACAATGCAAGACATACAT
TTCCACTATGGTCGGTTTCAGGAATTTCAAAAGAAATCTGACGTCAATGCAATTATCCATTATTTAAAAG
CTATAAAAATAGAACAGGCATCATTAACAAGGGATAAAAGTATCAATTCTTTGAAGAAATTGGTTTTAAG
GAAACTTCGGAGAAAGGCATTAGATCTGGAAAGCTTGAGCCTCCTTGGGTTCGTCTACAAATTGGAAGGA
AATATGAATGAAGCCCTGGAGTACTATGAGCGGGCCCTGAGACTGGCTGCTGACTTTGAGAACTCTGTGA
GACAAGGTCCTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270928
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270928.1, NP_001257857.1
RefSeq Size 4510 bp
RefSeq ORF 1344 bp
Locus ID 3434
Cytogenetics 10q23.31
Gene Summary 'This gene encodes a protein containing tetratricopeptide repeats that was originally identified as induced upon treatment with interferon. The encoded protein may inhibit viral replication and translational initiation. This gene is located in a cluster on chromosome 10 with five other closely related genes. There is a pseudogene for this gene on chromosome 13. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]'
Transcript Variant: This variant (3) contains an alternate internal exon and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3, 4, and 5 encode the same isoform (3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.