KLF7 (NM_001270942) Human Untagged Clone

CAT#: SC330895

KLF7 (untagged) - Homo sapiens Kruppel-like factor 7 (ubiquitous) (KLF7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KLF7
• Synonyms: UKLF
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270942, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGTGTTGGCTAGTTATAGTATATTCCAGGAGCTACAACTTGTCCACGACACCGGCTACTTCTCAG
  CTTTACCATCCCTGGAGGAGACCTGGCAGCAGACATGCCTTGAATTGGAACGCTACCTACAGACGGAGCC
  CCGGAGGATCTCAGAGACCTTTGGTGAGGACTTGGACTGTTTCCTCCACGCTTCCCCTCCCCCGTGCATT
  GAGGAAAGCTTCCGTCGCTTAGACCCCCTGCTGCTCCCCGTGGAAGCGGCCATCTGTGAGAAGAGCTCGG
  CAGTGGACATCTTGCTCTCTCGGGACAAGTTGCTATCTGAGACCTGCCTCAGCCTCCAGCCGGCCAGCTC
  TTCTCTAGACAGCTACACAGCCGTCAACCAGGCCCAGCTCAACGCAGTGACCTCATTAACGCCCCCATCG
  TCCCCTGAGCTCAGCCGCCATCTGGTCAAAACCTCACAAACTCTCTCTGCCGTGGATGGCACGGTGACGT
  TGAAACTGGTGGCCAAGAAGGCTGCTCTCAGCTCCGTAAAGGTGAGAAGCCTTATAAGTGCTCATGGGAG
  GGATGTGAGTGGCGTTTTGCACGAAGCGATGAGCTCACGAGGCACTACAGGAAACACACAGGTGCAAAGC
  CCTTCAAATGCAACCACTGCGACAGGTGTTTTTCCAGGTCTGACCATCTTGCCCTCCACATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270942
• ORF Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270942.1, NP_001257871.1
• RefSeq Size: 8021
• RefSeq ORF: 693
• Locus ID: 8609
• Protein Families: Transcription Factors
• Gene Summary: The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate splice site in the coding region that results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.