KLF7 (NM_001270944) Human Untagged Clone

CAT#: SC330897

KLF7 (untagged) - Homo sapiens Kruppel-like factor 7 (ubiquitous) (KLF7), transcript variant 4


  "NM_001270944" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KLF7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KLF7
Synonyms UKLF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270944, the custom clone sequence may differ by one or more nucleotides


ATGTTCCCGTCTTGGCCAACATGCCTTGAATTGGAACGCTACCTACAGACGGAGCCCCGGAGGATCTCAG
AGACCTTTGGTGAGGACTTGGACTGTTTCCTCCACGCTTCCCCTCCCCCGTGCATTGAGGAAAGCTTCCG
TCGCTTAGACCCCCTGCTGCTCCCCGTGGAAGCGGCCATCTGTGAGAAGAGCTCGGCAGTGGACATCTTG
CTCTCTCGGGACAAGTTGCTATCTGAGACCTGCCTCAGCCTCCAGCCGGCCAGCTCTTCTCTAGACAGCT
ACACAGCCGTCAACCAGGCCCAGCTCAACGCAGTGACCTCATTAACGCCCCCATCGTCCCCTGAGCTCAG
CCGCCATCTGGTCAAAACCTCACAAACTCTCTCTGCCGTGGATGGCACGGTGACGTTGAAACTGGTGGCC
AAGAAGGCTGCTCTCAGCTCCGTAAAGGTGGGAGGGGTCGCAACAGCTGCAGCAGCCGTGACGGCTGCGG
GGGCCGTTAAGAGTGGACAGAGCGACAGTGACCAAGGAGGGCTAGGGGCTGAAGCATGTCCCGAAAACAA
GAAGAGGGTTCACCGCTGTCAGTTTAACGGGTGCCGGAAAGTTTATACAAAAAGCTCCCACTTAAAGGCC
CACCAGAGGACTCACACAGGTGAGAAGCCTTATAAGTGCTCATGGGAGGGATGTGAGTGGCGTTTTGCAC
GAAGCGATGAGCTCACGAGGCACTACAGGAAACACACAGGTGCAAAGCCCTTCAAATGCAACCACTGCGA
CAGGTGTTTTTCCAGGTCTGACCATCTTGCCCTCCACATGAAGAGACATATCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001270944
ORF Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270944.1, NP_001257873.1
RefSeq Size 7954
RefSeq ORF 825
Locus ID 8609
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.