UCHL3 (NM_001270952) Human Untagged Clone

CAT#: SC330899

UCHL3 (untagged) - Homo sapiens ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) (UCHL3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UCHL3
• Synonyms: UCH-L3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270952, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCCTGAACTCCTTAGCATGGTACCAAGACCAGTCTGTGCAGTCTTACTTCTCTTTCCTATTACAG
  AAAAGTATGAAGTATTCAGAACAGAAGAGGAAGAAAAAATAAAATCTCAGGGACAAGATGTTACATCATC
  AGTATATTTCATGAAGCAAACAATCAGCAATGCCTGTGGAACAATTGGACTGATTCATGCTATTGCAAAC
  AATAAAGACAAGATGCACTTTGAATCTGGATCAACCTTGAAAAAATTCCTGGAGGAATCTGTGTCAATGA
  GCCCTGAAGAACGAGCCAGATACCTGGAGAACTATGATGCCATCCGAGTTACTCATGAGACCAGTGCCCA
  TGAAGGTCAGACTGAGGCACCAAGTATAGATGAGAAAGTAGATCTTCATTTTATTGCATTAGTTCATGTA
  GATGGGCATCTCTATGAATTAGATGGGCGGAAGCCATTTCCAATTAACCATGGTGAAACTAGTGATGAAA
  CTTTATTAGAGGATGCCATAGAAGTTTGCAAGAAGTTTATGGAGCGCGACCCTGATGAACTAAGATTTAA
  TGCGATTGCTCTTTCTGCAGCATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270952
• ORF Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270952.1, NP_001257881.1
• RefSeq Size: 1050
• RefSeq ORF: 585
• Locus ID: 7347
• Protein Families: Druggable Genome, Protease
• Gene Summary: The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (1) represents the longer transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.