ZFAND2B (NM_001270999) Human Untagged Clone

CAT#: SC330907

ZFAND2B (untagged) - Homo sapiens zinc finger, AN1-type domain 2B (ZFAND2B), transcript variant 3


  "NM_001270999" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZFAND2B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZFAND2B
Synonyms AIRAPL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270999, the custom clone sequence may differ by one or more nucleotides


ATGGAGTTTCCGGACCTCGGCGCTCACTGTTCGGAGCCGAGCTGTCAGCGCTTGGATTTTCTGCCGCTTA
AGTGTGATGCCTGCTCAGGCATCTTCTGCGCAGACCATGTGGCCTACGCCCAGCATCACTGTGGATCTGC
TTACCAAAAGATCTTCACCAATAAGTGTGAACGCGCTGGCTGCCGGCAGCGAGAAATGATGAAACTGACC
TGTGAACGCTGTAGCCGAAACTTCTGCATCAAGCACCGGCATCCACTGGACCATGATTGCTCTGGGGAGG
GGCACCCAACCAGCCGGGCAGGACTTGCTGCCATCTCCAGAGCACAAGCTGTGGCTTCTACAAGCACTGT
CCCCAGCCCAAGTCAAACCATGCCTTCCTGTACCTCTCCCAGCAGAGCCACAACCCGATCTCCGTCCTGG
ACAGCCCCTCCAGTGATTGCTTTGCAGAATGGCCTGAGTGAGGATGAAGCTCTGCAGCGGGCCCTGGAAA
TGTCCCTGGCAGAAACCAAACCCCAGGTTCCAAGTTGTCAGGAGGAAGAAGACCTAGCTTTAGCACAAGC
ACTGTCAGCCAGTGAGGCAGAATACCAGCGGCAGCAGGCCCAGAGCCGCAGCTCGAAGCCGTCCAACTGC
AGCCTGTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270999
ORF Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270999.1, NP_001257928.1
RefSeq Size 1070
RefSeq ORF 642
Locus ID 130617
Gene Summary This gene encodes a protein containing AN1-type zinc-fingers and ubiquitin-interacting motifs. The encoded protein likely associates with the proteosome to stimulate the degradation of toxic or misfolded proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.