TFPI2 (NM_001271003) Human Untagged Clone

CAT#: SC330908

TFPI2 (untagged) - Homo sapiens tissue factor pathway inhibitor 2 (TFPI2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TFPI2
• Synonyms: PP5; REF1; TFPI-2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271003, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCCCGCTCGCCCCCTGGGGCTGTCGATTCTGCTGCTTTTCCTGACGGAGGCTGCACTGGGCGATG
  CTGCTCAGGAGCCAACAGACTACGGACCCTGCCGGGCCCTACTTCTCCGTTACTACTACGACAGGTACAC
  GCAGAGCTGCCGCCAGTTCCTGTACGGGGGCTGCGAGGGCAACGCCAACAATTTCTACACCTGGGAGGCT
  TGCGACGATGCTTGCTGGAGGATAGAAAAAGTTCCCAAAGTTTGCCGGCTGCAAGTGAGTGTGGACGACC
  AGTGTGAGGGGTCCACAGAAAAGTATTTCTTTAATCTAAGTTCCATGACATGTGAAAAATTCTTTTCCGG
  TGGGTGTCACCGGAACCGGATTGAGAACAGGTTTCCAGATGAAGCTACTTGTATGGGCTTCTGCGCACCA
  AAGAAAATTCCATCATTTTGCTACAGTCCAAAAGATGAGGGACTGTGCTCTGCCAATGTGACTCGCTATT
  ATTTTAATCCAAGATACAGAACCTGTGATGCTTTCACCTATACTGGCTGTGGAGGGAATGACAATAACTT
  TGTTAGCAGGGAGGATTGCAAACGTGCATGTGCAAAAGCTTTGAAAAAGAAAAAGAAGATGCCAAAGCTT
  CGCTTTGCCAGTAGAATCCGGAAAATTCGGAAGAAGCAATTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271003
• ORF Size: 675 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271003.1, NP_001257932.1
• RefSeq Size: 2411
• RefSeq ORF: 675
• Locus ID: 7980
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a member of the Kunitz-type serine proteinase inhibitor family. The protein can inhibit a variety of serine proteases including factor VIIa/tissue factor, factor Xa, plasmin, trypsin, chymotryspin and plasma kallikrein. This gene has been identified as a tumor suppressor gene in several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.