UBE2W (NM_001271015) Human Untagged Clone

CAT#: SC330912

UBE2W (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2W
• Synonyms: UBC-16; UBC16
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271015, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTGAGCCCCCGCGGCGTGACGCGAGCACGGCAGCTCCTCCCCCTGCGTCTCTGGCCTCGCCGGTCTT
  GGGGGGATGGTTCCATCATGGCGTCAATGCAGAAACGACTACAGAAAGAACTGTTGGCTTTGCAAAATGA
  CCCACCTCCTGGAATGACCTTAAATGAGAAGAGTGTTCAAAATTCAATTACACAGTGGATTGTAGACATG
  GAAGGTGCACCAGGTACCTTATATGAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGATATC
  CTTTTGACTCTCCTCAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGCAATGG
  TCATATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGTCTTAGC
  ATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCTTTTTATGTGCGAACAT
  GTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGAACTGAAATCTGCCTTCATACTATCTATTAC
  GGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271015
• ORF Size: 567 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271015.1, NP_001257944.1
• RefSeq Size: 951
• RefSeq ORF: 567
• Locus ID: 55284
• Protein Families: Transcription Factors
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, lacks a portion of the 3' coding region, and differs in the 3' UTR, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.