CD16b (FCGR3B) (NM_001271035) Human Untagged Clone

CAT#: SC330918

FCGR3B (untagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FCGR3B
• Synonyms: CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271035, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTGGAGGGACTGGGGAAAGGCTGTTTACTCCCTCCTGTCTAGTCGGCTTGGTCCCTTTAGGGCTCC
  GGATATCTTTGGTGACTTGTCCACTCCAGTGTGGCATCATGTGGCAGCTGCTCCTCCCAACTGCTCTGCT
  ACTTCTAGTTTCAGCTGGCATGCGGACTGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTAC
  AGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACAC
  AGTGGTTTCACAATGAGAACCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCAA
  CGACAGTGGAGAGTACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCAT
  ATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATTCACCTGAGGTGTC
  ACAGCTGGAAGAACACTGCTCTGCATAAGGTCACATATTTACAGAATGGCAAAGACAGGAAGTATTTTCA
  TCATAATTCTGACTTCCACATTCCAAAAGCCACACTCAAAGATAGCGGCTCCTACTTCTGCAGGGGGCTT
  GTTGGGAGTAAAAATGTGTCTTCAGAGACTGTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAACCA
  TCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGA
  CACAGGACTATATTTCTCTGTGAAGACAAACATTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271035
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271035.1, NP_001257964.1
• RefSeq Size: 2391 bp
• RefSeq ORF: 807 bp
• Locus ID: 2215
• Cytogenetics: 1q23.3
• Protein Families: ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
• Protein Pathways: Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus
• Gene Summary: 'The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012]'
  Transcript Variant: This variant (3) uses an alternate in-frame splice site at the 5' end of an exon compared to variant 1. The resulting isoform (6) has the same N- and C-termini but is one aa shorter compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.