RAP2C (NM_001271186) Human Untagged Clone

CAT#: SC330928

RAP2C (untagged) - Homo sapiens RAP2C, member of RAS oncogene family (RAP2C), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAP2C
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271186, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGGAATACAAGGTAGTGGTGTTAGGGAGTGGAGGGGTTGGCAAATCTGCCCTTACTGTGCAGTTTG
  TCACTGGGACTTTCATTGAGAAATATGACCCCACCATTGAAGATTTCTACCGCAAAGAGATCGAAGTGGA
  CTCTTCCCCCTCCGTGCTGGAAATTCTGGACACCGCAGGAACTGAGCAGTTTGCCTCCATGAGAGATCTC
  TACATCAAAAACGGCCAAGGTTTCATCCTGGTTTATAGCCTGGTTAATCAACAGTCTTTTCAGGATATCA
  AGCCAATGAGAGATCAAATTGTCAGAGTGAAGAGATATGAAAAAGTCCCACTAATCCTAGTAGGAAATAA
  AGTGGATCTGGAACCAGAAAGAGAGGTTATGTCTTCAGAAGGCAGAGCTCTGGCTCAAGAATGGGGCTGT
  CCTTTCATGGAGACATCGGCAAAAAGTAAATCAATGGTGGATGAACTTTTTGCTGAGATCGTCAGGCAAA
  TGAACTATTCATCCCTGCCGGAGAAGCAAGATCAGTGTTGTACAACTTGTGTCGTCCAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271186
• ORF Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271186.1, NP_001258115.1
• RefSeq Size: 4006
• RefSeq ORF: 552
• Locus ID: 57826
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of the Ras-related protein subfamily of the Ras GTPase superfamily. Members of this family are small GTPases that act as molecular switches to regulate cellular proliferation, differentiation, and apoptosis. This protein has been reported to activate in vitro transcriptional activity of the serum response element. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
  Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same isoform (1).